Eugenia luschnathiana

(O.Berg) Klotzsch ex B.D.Jacks. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Eugenia

At a glance

Occurrence records131

Data sources10

Biological traits23

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Eugenia luschnathiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility131 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF131 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

De pitomba is een plant uit de mirtefamilie (Myrtaceae). Het is een struik of tot 9 m hoge, groenblijvende boom, die endemisch is in Bahia, een deelstaat van Brazilië. De bladeren zijn tegenoverstaand, langwerpig-lancetvormig, tot 7,5 cm lang, glanzend donkergroen aan de bovenzijde en dof bleekgroen aan de onderzijde. De witte bloemen groeien aan lange bloemstelen in de bladoksels. Ze bestaan uit vier kroonbladeren. De vruchten zijn 2-3,5 cm groot, rond en geel tot lichtoranje van kleur. Het vruchtvlees is oranje, sappig en heeft een aangename zoetzure, aromatische smaak die lijkt op abrikoos. De vrucht bevat één tot vier, tot 1,6 cm grote zaden. De boom is intolerant voor alkalische grond en heeft vochtige, zure grond nodig. Vanwege deze reden wordt de pitomba vaak geënt op een onderstam van de Surinaamse kers, die wel tolerant is voor alkalische grond.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height9 m

Plant height max10 m

Plant height min4 m

Seed mass11 mg

Seed mass max11 mg

Seed mass min11 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTCerrado (lato sensu), Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)440 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.06 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eugenia luschnathiana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX789272.1 ↗727 bp

ACGT

GTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGGGGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCC …

Eugenia luschnathiana 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eugenia luschnathiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Pedrosa, A. 1999. Citogenética de angiospermas coletadas em Pernambuco - V. Acta Bot. Brasil. 13(1): 49–60.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type131 records

Wild obs. + sensor14

Museum / vouchered116

Cultivated / captive1

Origin

Native38

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 7≤1 km 3≤10 km 1

11 georeferenced · 3 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1>10 km 1

2 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence116

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidade Federal do Rio Grande do Nortelocation not on record	36
Universidade Federal do Ceara, Departamento de Biologialocation not on record	10
Fortaleza, BR	10
Bronx, US	6
UnBlocation not on record	6
Miami, US	5
Laboratorio de Ictiologialocation not on record	5
JBRJlocation not on record	4
Université de Bordeauxlocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Instituto do Meio Ambientelocation not on record	2
Chaguaramas, TT	2
Salvador, BR	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
IPA/SPlocation not on record	2
Departamento de Sistematica e Ecologialocation not on record	2
UFSJlocation not on record	1
UFSCarlocation not on record	1
UFABClocation not on record	1
Feira de Santana, BR	1
Universidade Federal de Sergipe (UFS)location not on record	1
UFBAlocation not on record	1
Masindi, UG	1
Istituto Agrario Castelnuovolocation not on record	1
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	1
Brasília, BR	1
UNITINSlocation not on record	1
UNICAMPlocation not on record	1
UFRRJlocation not on record	1
UNIVASFlocation not on record	1
UFRPElocation not on record	1

31 institutions · 114 of 116 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Eugenia luschnathiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)