Eugenia klotzschiana

O.Berg · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Eugenia

At a glance

Occurrence records182

Data sources9

Biological traits15

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Eugenia klotzschiana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility182 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF182 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT · NCBI≈212 Mbp

01Narrative

Eugenia klotzschiana, or cerrado pear, is a species of plant in the family Myrtaceae. It is found in Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height1 m

Plant height max4 m

Life cycle & reproduction4

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: shrub

Habitat GIFTCerrado (lato sensu), Floresta Estacional Semidecidual

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eugenia klotzschiana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP035938.1 ↗671 bpBrazil

ACGT

GTCCACCTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGC …

Eugenia klotzschiana voucher Faria, 2006 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Eugenia klotzschiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈211 860 844 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Eugenia klotzschiana0.21 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 26

2n 331×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 26

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type182 records

Wild obs. + sensor22

Museum / vouchered160

Origin

Native81

Range

Area of Occupancy AOO384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 6≤1 km 7≤10 km 1>10 km 8

22 georeferenced

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6>10 km 2

8 georeferenced · 152 without coordinates

Open the institutions mapphysical evidence160

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UnBlocation not on record	21
Bronx, US	19
Bogotá, D.C., CO	17
Brasília, BR	11
Ivano-Frankivsk, UA	11
JBRJlocation not on record	7
San Jose State University, Museum of Birds and Mammalslocation not on record	7
Cenargenlocation not on record	6
Jataí / Setor Industrial, BR	5
Brasília, BR	5
Chicago, US	5
UFVJMlocation not on record	5
Kew, GB	4
UFSJlocation not on record	3
CJBGlocation not on record	3
UNICAMPlocation not on record	3
UFMGlocation not on record	2
UEGlocation not on record	2
ASUlocation not on record	2
UFSCarlocation not on record	2
Feira de Santana, BR	2
UFMSlocation not on record	2
Universidade de São Paulolocation not on record	1
IPA/SPlocation not on record	1
UFPIlocation not on record	1
Universidade Federal de Goiáslocation not on record	1
La Paz, BO	1
Santa Cruz de la Sierra, BO	1
Université de Bordeauxlocation not on record	1
UFABClocation not on record	1
Seropédica, BR	1
Laboratorio de Ictiologialocation not on record	1
UNESP-RClocation not on record	1
Ural Federal University "B. N. Yeltsin"location not on record	1
UFRRJlocation not on record	1
Teresina, BR	1
UNITINSlocation not on record	1

37 institutions · 159 of 160 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)