Eugenia cuprea — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Eugenia

At a glance

Occurrence records55

Data sources4

Biological traits13

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Eugenia cuprea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility55 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources13 traits

Occurrence & distributionGBIF55 records

DNA & barcodingNCBIsequences

01Narrative

Eugenia cuprea là một loài thực vật có hoa trong Họ Đào kim nương. Loài này được (O.Berg) Nied. mô tả khoa học đầu tiên năm 1893.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology7

Plant height11.51 m

Seed length16 mm

Seed length max16 mm

Seed length min16 mm

Seed mass1 000 mg

Seed mass max1 000 mg

Seed mass min1 000 mg

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climberself-supporting

Growth formTree (T)

Woodinesswoody

Physiology & chemistry2

Specific leaf area (SLA)11.84 mm²/mg

Wood density443 mg/cm³

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eugenia cuprea has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG707984.1 ↗702 bpBrazil · 2012

ACGT

AGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCTAGCAGAATGACCAGAGAACTCGTAAC …

Eugenia cuprea isolate PECB073 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL2ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type55 records

Museum / vouchered38

Other17

Range

Area of Occupancy AOO144 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence38

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UNICAMPlocation not on record	19
Istituto Agrario Castelnuovolocation not on record	8
ASUlocation not on record	4
Saint Louis, US	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Bronx, US	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1

7 institutions · 37 of 38 vouchered records shown · 1 without an institution code