Eudistoma capsulatum

(Van Name, 1902) · species

image placeholder — illustration coming later

Animalia/Chordata/Ascidiacea/Aplousobranchia/Polycitoridae/Eudistoma

At a glance

Occurrence records257

Data sources7

Biological traits4

DNA specimens16

eDNA detections19

Sources7 archives

Databases and archives Eudistoma capsulatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility134 records↗

OBISOcean Biodiversity Information System123 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS257 records

Environmental DNA1 datasets · 1 countries19 detections

DNA & barcodingBOLD16 specimens

01Narrative

Eudistoma capsulatum is een zakpijpensoort uit de familie van de Polycitoridae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1902 door Van Name.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max13 m

Depth min0 m

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eudistoma capsulatum has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections19

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P535 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

202Tmostly conserved

250Gvariable

259Gmostly conserved

265Amostly conserved

455Amostly conserved

510Tmostly conserved

GATTTGGTCTGCTTTTTTTGGAGCTAGTTTAAGTTTTTTAATCCGAATAGAATTATCCCAGACGGGGCAAGTGATTAGAAATGGGCAAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes3

BIN1

Most divergent pair0.56%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type257 records

Wild obs. + sensor7

Museum / vouchered250

Origin

Native1

Range

Area of Occupancy AOO240 km²

Depth

0–200 m sunlit113

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 17 m · max 73 m · 113 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 4 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 250 records without

Open the institutions mapphysical evidence250

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	108
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	5
Texas Cooperative Wildlife Collectionlocation not on record	1

4 institutions · 119 of 250 vouchered records shown · 12 without an institution code

09Environmental DNA19 detections

Where the DNA of Eudistoma capsulatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 6.70–14.2

Seasonal swing summer↔winter27.0 °C

Max temp (day)16.6 °C 13.4–18.4

Min temp (night)8.20 °C 1.90–12.4

Precipitation79.6 mm/mo 64.1–91.6

Air humidity57.3 % 56.5–60.2

Moisture balance-23.7 mm/mo -38.4–-7.90

Vapour deficit641 Pa 432–733

Wind speed6.40 m/s 5.80–6.40

Cloud cover42.4 % 36.7–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)