Eucalyptus terebra

L.A.S.Johnson & K.D.Hill · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Eucalyptus

At a glance

Occurrence records115

Data sources6

Biological traits31

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eucalyptus terebra's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF115 records

DNA & barcodingNCBIsequences

01Narrative

Eucalyptus terebra, commonly known as Balladonia gimlet, is a species of gimlet that is endemic to Western Australia. It has satiny or glossy bark on its fluted trunk, linear to narrow lance-shaped adult leaves, flower buds in groups of seven, yellowish flowers and conical to hemispherical fruit. It is one of the seven species of gimlet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit length4.5 mm

Fruit width11 mm

Leaf length77.5 mm

Leaf mass per area381 g/m2

Leaf width8.5 mm

Petiole length0.9 cm

Plant height11.5 m

Plant height max11 m

Plant height min2.5 m

Seed length1.5 mm

Seed mass0.652 mg

Life cycle & reproduction8

Dispersal typeself

Flowering timennnnnnnynnyn

Life formtree

Life spanperennial

Pollination syndromebird+insect+mammal

Raunkiær life formphanerophyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelinear narrowly_lanceolate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eucalyptus terebra has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKT631365.1 ↗665 bp

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCAAGCAGAATGACCAGAGAACCGGTAACAAACTCAATGGGGA …

Eucalyptus terebra 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type115 records

Wild obs. + sensor7

Museum / vouchered105

Cultivated / captive3

Origin

Native17

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 4≤1 km 1≤10 km 1

6 georeferenced · 1 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 18≤1 km 36≤10 km 33>10 km 4

91 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence105

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	33
Kensington, AU	32
Mount Annan, AU	17
Adelaide, AU	11
Museo Entomologico de Leonlocation not on record	8
Kew, GB	2
Armidale, AU	1
BGPAlocation not on record	1

8 institutions · 105 of 105 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)