Euapta lappa

(J.Müller, 1850) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Holothuroidea/Apodida/Synaptidae/Euapta

At a glance

Occurrence records358

Data sources8

Biological traits5

DNA specimens5

eDNA detections8

Sources8 archives

Databases and archives Euapta lappa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility301 records↗

OBISOcean Biodiversity Information System57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS358 records

Environmental DNA2 datasets · 3 countries8 detections

DNA & barcodingBOLD5 specimens

01Narrative

Euapta lappa, the beaded sea cucumber, is a species of sea cucumbers in the family Synaptidae in the phylum Echinodermata. It is found on coral reefs in the Caribbean region.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length100 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max24 m

Depth min0 m

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euapta lappa has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections8

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACCTTATATTTACTTTTTGGAGTTTGAGCTGGTCTTGTAGGGACCTCTTTAAGAGTTATAATTCGTATGGAGTTAGGACAGGCGGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leptosynapta transgressorsame family10.3%Leptosynapta clarkisame family10.5%Chiridota laevissame order14.0%Leptosynapta decariasame family14.4%Chiridota albatrossiisame order14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type358 records

Wild obs. + sensor231

Museum / vouchered126

Other1

Origin

Native1

Range

Area of Occupancy AOO784 km²

Depth

0–200 m sunlit29

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 7.6 m · max 170 m · 29 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 71≤1 km 64≤10 km 16>10 km 13

164 georeferenced · 67 without coordinates

Open the mapobservation + sensor231

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 17≤1 km 5≤10 km 9>10 km 4

35 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	19
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	15
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	15
Cambridge, US	7
UM-RSMASlocation not on record	6
Los Angeles, US	6
CASlocation not on record	2
Stockholm, SE	2
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	1
Brussels, BE	1
Texas Cooperative Wildlife Collectionlocation not on record	1
Universidad CESlocation not on record	1
Universidad de Antioquia (UdeA)location not on record	1

13 institutions · 77 of 126 vouchered records shown · 11 without an institution code

09Environmental DNA8 detections

Where the DNA of Euapta lappa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries3

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 22.9–27.5

Seasonal swing summer↔winter6.10 °C

Max temp (day)23.9 °C 23.9–31.3

Min temp (night)22.1 °C 20.7–24.5

Precipitation58.5 mm/mo 29.6–82.2

Air humidity59.7 % 51.8–61.6

Vapour deficit1,128 Pa 1,122–1,690

Cloud cover32.5 % 21.4–32.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)