Euapta godeffroyi

(Semper, 1868) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Holothuroidea/Apodida/Synaptidae/Euapta

At a glance

Occurrence records634

Data sources8

Biological traits6

DNA specimens11

eDNA detections3

Sources8 archives

Databases and archives Euapta godeffroyi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility499 records↗

OBISOcean Biodiversity Information System135 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS634 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD11 specimens

01Narrative

Euapta godeffroyi, the sticky snake sea cucumber, is a species of sea cucumber in the family Synaptidae. It is found on coral reefs in the tropical Indo-Pacific region.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length40 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits3

Depth max77 m

Depth min0 m

Vulnerability30

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euapta godeffroyi has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections3

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

55Tmostly conserved

97Amostly conserved

103Tmostly conserved

133Cmostly conserved

371Cvariable

412Gmostly conserved

439Gmostly conserved

466Tmostly conserved

484Tmostly conserved

565Tvariable

AGTGATGATAGGTGGGTTTGGGAATTGGTTGGTTCCTCTAATGATAGGAGCCCCTGATATGGCTTTCCCCCGTATGAAAAAAATGAGTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.81%

Haplotypes3

BIN1

Most divergent pair0.76%

AsiaAfrica

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type634 records

Wild obs. + sensor353

Museum / vouchered280

Other1

Range

Area of Occupancy AOO1 504 km²

Depth

0–200 m sunlit28

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 6 m · max 65 m · 28 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 127≤1 km 95≤10 km 43>10 km 28

293 georeferenced · 60 without coordinates

Open the mapobservation + sensor353

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 22≤1 km 33≤10 km 24>10 km 8

87 georeferenced · 193 without coordinates

Open the institutions mapphysical evidence280

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	56
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	15
Washington, US	15
Cambridge, US	11
CASlocation not on record	10
Sydney, AU	9
Brussels, BE	6
Western Australian Museumlocation not on record	6
RBINS-Scientific Heritagelocation not on record	6
Universidad Católica del Nortelocation not on record	5
University of Floridalocation not on record	4
Royal Museum for Central Africalocation not on record	3
Paris, FR	2
Los Angeles, US	2
Laboratorio de Ecosistemas Marinos y Acuicultura, Centro Universitario de Ciencias Biológicas y Agropecuarias, Universidad de Guadalajaralocation not on record	1
University of California Museum of Paleontologylocation not on record	1
BIKlocation not on record	1
Natick, US	1
UM-RSMASlocation not on record	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
Auckland, NZ	1
Universidad del Valle (UniValle)location not on record	1

22 institutions · 158 of 280 vouchered records shown · 10 without an institution code

09Environmental DNA3 detections

Where the DNA of Euapta godeffroyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.8 °C 26.6–27.0

Seasonal swing summer↔winter5.50 °C

Max temp (day)28.4 °C 28.0–28.8

Min temp (night)25.3 °C 24.5–26.1

Precipitation9.10 mm/mo 7.90–10.3

Air humidity60.3 % 59.6–60.9

Vapour deficit1,397 Pa 1,394–1,400

Cloud cover8.30 % 6.50–10.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)