Eualetes tulipa

(Rousseau, 1843) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Vermetidae/Eualetes

At a glance

Occurrence records118

Data sources8

Biological traits0

DNA specimens16

eDNA detections7

Sources8 archives

Databases and archives Eualetes tulipa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility52 records↗

OBISOcean Biodiversity Information System66 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS118 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD16 specimens

01Narrative

Eualetes tulipa is a species of sea snail, a marine gastropod mollusk in the family Vermetidae, the worm snails or worm shells.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eualetes tulipa has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes11

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

59Cvariable

79Tvariable

91Avariable

139Tvariable

154Tvariable

158Cvariable

197Cvariable

205Gvariable

232Tvariable

235Tvariable

278Tvariable

298Avariable

307Avariable

407Cvariable

415Tvariable

424Cvariable

454Avariable

580Avariable

TACTTTATATATTTTGTTTGGTATGTGGTCGGGGTTGGTTGGGACTGCCTTAAGCTTACTAATCCGGGCAGAGTTGGGTCAGCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes3

BIN1

Most divergent pair2.7%

N.AmericaOther

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_014585 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1ATP8ATP6ND5COX3ND2ND1ND6CYTBND4LND4ND3COX2s-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type118 records

Wild obs. + sensor28

Museum / vouchered89

Fossil1

Range

Area of Occupancy AOO160 km²

Depth

0–200 m sunlit2

200–1000 m twilight6

1–4 km midnight0

>4 km abyssal0

median 265 m · max 350 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 26 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 1≤1 km 4≤10 km 2>10 km 1

8 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SCSDlocation not on record	8
Santa Barbara Museum of Natural Historylocation not on record	5
Washington, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Denver, US	3
Chicago, US	2
Universidad Simón Bolívarlocation not on record	1
Universidad del Marlocation not on record	1
Delaware Museum of Nature and Sciencelocation not on record	1
Cambridge, US	1

10 institutions · 30 of 89 vouchered records shown · 6 without an institution code

09Environmental DNA7 detections

Where the DNA of Eualetes tulipa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

sand flat and fringing reefpatch reef with pilings, etc

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 23.6–23.6

Seasonal swing summer↔winter3.30 °C

Max temp (day)25.0 °C

Min temp (night)22.4 °C

Precipitation50.7 mm/mo

Air humidity59.7 %

Vapour deficit1,166 Pa

Cloud cover33.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)