Euagoras plagiatus

(Burmeister, 1834) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Reduviidae/Euagoras

At a glance

Occurrence records516

Data sources6

Biological traits0

DNA specimens13

eDNA detections14

Sources6 archives

Databases and archives Euagoras plagiatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility516 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF516 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD13 specimens

01Narrative

Euagoras plagiatus is an Asian species of assassin bugs (insects in the family Reduviidae), in the subfamily Harpactorinae. It has been investigated as a potential biocontrol agent for Pterophorus lienigianus Z., which is a pest of eggplant (Solanum melongena).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euagoras plagiatus has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections14

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P590 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

27Gmostly conserved

36Cmostly conserved

39Amostly conserved

46Tvariable

57Tmostly conserved

66Cmostly conserved

72Tmostly conserved

78Cmostly conserved

87Cmostly conserved

90Cmostly conserved

120Amostly conserved

126Tmostly conserved

135Tmostly conserved

144Tmostly conserved

153Amostly conserved

168Amostly conserved

169Cmostly conserved

186Tmostly conserved

189Amostly conserved

195Tmostly conserved

210Tmostly conserved

237Tmostly conserved

243Cmostly conserved

252Tmostly conserved

258Amostly conserved

259Tmostly conserved

261Gmostly conserved

270Tmostly conserved

282Amostly conserved

285Tmostly conserved

290Cmostly conserved

291Tmostly conserved

294Gmostly conserved

300Amostly conserved

306Tmostly conserved

309Tmostly conserved

312Tmostly conserved

315Avariable

319Tmostly conserved

333Amostly conserved

351Amostly conserved

373Tmostly conserved

378Tmostly conserved

393Avariable

400Tmostly conserved

423Tmostly conserved

432Cmostly conserved

441Amostly conserved

444Cvariable

450Cvariable

453Amostly conserved

456Cvariable

462Amostly conserved

474Gmostly conserved

480Cmostly conserved

504Cmostly conserved

507Cvariable

513Cmostly conserved

516Gmostly conserved

522Amostly conserved

525Tmostly conserved

543Tmostly conserved

555Amostly conserved

585Tmostly conserved

588Tmostly conserved

GCAGGTGTCGTGGGGACTTCGCTATCGTGAATGATCCGAGTAGAATTAGGTACACCTGGTACCTTCATTGGTAATGACCAAATTTACAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes11

BINs2

Most divergent pair8.3%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Isyndus reticulatussame family14.6%Epidaus famulussame family15.4%Coranus kerzhnerisame family15.6%Coranus woodroffeisame family15.6%Callistodema fasciatasame family15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type516 records

Wild obs. + sensor505

Museum / vouchered11

Range

Area of Occupancy AOO1 496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 166≤1 km 127≤10 km 25>10 km 62

380 georeferenced · 125 without coordinates

Open the mapobservation + sensor505

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museum of Natural Sciencelocation not on record	10
Champaign, US	1

2 institutions · 11 of 11 vouchered records shown

09Environmental DNA14 detections

Where the DNA of Euagoras plagiatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)