Etmopterus bigelowi

Shirai & Tachikawa, 1993 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Squaliformes/Etmopteridae/Etmopterus

At a glance

Occurrence records484

Data sources10

Biological traits7

DNA specimens23

eDNA detections21

Sources10 archives

Databases and archives Etmopterus bigelowi's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility222 records↗

OBISOcean Biodiversity Information System262 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS484 records

Environmental DNA1 datasets · 3 countries21 detections

DNA & barcodingBOLD23 specimens

01Narrative

The blurred lanternshark (Etmopterus bigelowi) is a little-known species of dogfish shark in the family Etmopteridae, found around the world in benthic and pelagic habitats from a depth of 110 m to over 1 km down. This shark forms the E. pusillus species group with the smooth lanternshark, which are distinguished from other members of its family by having irregularly arranged, flat-topped dermal denticles that give them a "smooth" appearance. Both species are slender-bodied with long heads, two dorsal fins bearing spines, no anal fins, and light-emitting photophores. The blurred lanternshark is larger, reaching 67 cm or more in length. This species feeds on small squid, fishes, and fish eggs, and is ovoviviparous. It has been assessed as of Least Concern by the International Union for Conservation of Nature, because of its wide distribution and lack of threat from fishing pressure.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length67 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-oceanic

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max1 000 m

Depth min163 m

Vulnerability49.2

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Etmopterus bigelowi has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes1

eDNA detections21

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

71Cvariable

232Tmostly conserved

263Tvariable

268Gmostly conserved

275Cmostly conserved

307Gmostly conserved

337Tvariable

352Avariable

361Cvariable

364Tvariable

394Tvariable

451Cvariable

492Cmostly conserved

544Cvariable

613Tvariable

622Tmostly conserved

637Tmostly conserved

643Tvariable

CCTATACTTAATCTTTGGTGCATGAGCAGGTATGGTAGGTACAGCCTTAAGTTTACTTATCCGAGCAGAACTAAGCCAACCGGGAACTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes8

BINs2

Most divergent pair12.0%

N.AmericaOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Etmopterus pusillussame genus6.0%Etmopterus mollerisame genus8.6%Etmopterus brachyurussame genus8.7%Etmopterus lucifersame genus9.5%Etmopterus gracilispinissame genus10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type484 records

Wild obs. + sensor51

Museum / vouchered426

Other7

Origin

Native9

Range

Area of Occupancy AOO708 km²

Depth

0–200 m sunlit1

200–1000 m twilight86

1–4 km midnight1

>4 km abyssal0

median 513 m · max 1 423 m · 88 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 19

20 georeferenced · 31 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 35≤1 km 70≤10 km 57>10 km 26

188 georeferenced · 238 without coordinates

Open the institutions mapphysical evidence426

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	66
FishBaselocation not on record	26
Sydney, AU	20
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	17
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	16
Washington, US	12
Cambridge, US	7
Texas Cooperative Wildlife Collectionlocation not on record	6
University of Texas Biodiversity Collections (UTBC)location not on record	3
CASlocation not on record	3
Florida State University Coastal and Marine Laboratorylocation not on record	3
Los Angeles, US	3
Museums Victorialocation not on record	2
Museu de Zoologia da Universidade de Sao Paulolocation not on record	2
Paris, FR	2
ICM-CSIClocation not on record	1
University of Mazandaranlocation not on record	1
Instituto Nacional de Investigacion y Desarrollo Pesquerolocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
CSIRO, Australian National Fish Collectionlocation not on record	1
University of California San Diegolocation not on record	1

22 institutions · 195 of 426 vouchered records shown · 10 without an institution code

09Environmental DNA21 detections

Where the DNA of Etmopterus bigelowi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 16.8–24.2

Seasonal swing summer↔winter6.80 °C

Max temp (day)23.9 °C 18.0–25.7

Min temp (night)20.2 °C 15.4–23.2

Precipitation71.2 mm/mo 6.70–155

Air humidity58.4 % 56.6–64.0

Vapour deficit1,015 Pa 823–1,129

Cloud cover23.8 % 16.4–29.8

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)