Erythronium hendersonii

S.Watson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Erythronium

At a glance

Occurrence records671

Data sources11

Biological traits14

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Erythronium hendersonii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility671 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF671 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Erythronium hendersonii, or Henderson's fawn lily, is a plant in the lily family native to southwestern Oregon, and northern California. It can be locally very abundant within its range which is in the Rogue River, and Applegate River drainage basins in Josephine County and Jackson County in Oregon, and well as sites in Siskiyou, Del Norte, and Mendocino Counties in California.Calflora taxon report, Erythronium hendersonii S. WatsonClennett, C. (2014). The genus Erythronium: 1-158. Kew Publishing, Kew.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass5.57 mg

Seed mass max5.96 mg

Seed mass min5.06 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erythronium hendersonii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences4

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF485290.1 ↗624 bp

ACGT

TCGATACCCGACCGAAAGACCGTGAACCTGTAAACGGATATCACCATGGTTGTTGGGCAAGCCCGGCCTCCTTGGACTCGTGCTGCCCCC …

Erythronium hendersonii internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Erythronium hendersonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · eflora

CCDB · book-atlas-flowering-plants — F. H. Smith 1955

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type671 records

Wild obs. + sensor552

Museum / vouchered118

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 349≤1 km 67≤10 km 32>10 km 34

482 georeferenced · 70 without coordinates

Open the mapobservation + sensor552

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 1≤1 km 42≤10 km 49>10 km 2

94 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence118

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	58
Ashland, US	17
WTUlocation not on record	7
Pullman, US	6
Chongqing Museumlocation not on record	4
Portland, US	3
Bronx, US	2
Arcata, US	2
University of Stellenboschlocation not on record	2
KNFHClocation not on record	2
Boise, US	1
Fredericton Stock Culture Collectionlocation not on record	1
Bend, US	1
Vancouver, CA	1
Provo, US	1
Portland, US	1
CASlocation not on record	1
Claremont, US	1
Logan, US	1
Moscow, US	1
KNFYlocation not on record	1
Santa Barbara, US	1
Angwin, US	1

23 institutions · 116 of 118 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Erythronium hendersonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)