Erysiphe syringae — The Life Data

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Erysiphe

At a glance

Occurrence records843

Data sources9

Biological traits0

DNA specimens5

eDNA detections4

Sources9 archives

Databases and archives Erysiphe syringae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility843 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF843 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Powdery mildew of lilac, or Erysiphe syringae (formerly Microsphaera syringae) is a fungal pathogen of lilacs.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erysiphe syringae has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences10

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV416508.1 ↗347 bpUSA · 2010

ACGT

AGCGCGTCCGCCAAAGACCCAACCAAAACTCATGTTTTTTTTCGTCGTCTCAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGA …

Erysiphe syringae voucher NCSLG18183 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type843 records

Wild obs. + sensor490

Museum / vouchered353

Range

Area of Occupancy AOO2 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 290≤1 km 27≤10 km 105>10 km 15

437 georeferenced · 53 without coordinates

Open the mapobservation + sensor490

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 12≤1 km 76≤10 km 70>10 km 11

169 georeferenced · 184 without coordinates

Open the institutions mapphysical evidence353

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	85
Champaign, US	40
Helsinki, FI	36
Karlsruhe, DE	13
CA	9
Zürich, CH	7
Mlocation not on record	6
WU-MYClocation not on record	6
ILLSlocation not on record	2
Kew, GB	1
Gijón, ES	1
Auckland, NZ	1
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	1

13 institutions · 208 of 353 vouchered records shown · 145 without an institution code

09Environmental DNA4 detections

Where the DNA of Erysiphe syringae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.