Erysiphe platani

(Howe) U.Braun & S.Takam. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Erysiphe

At a glance

Occurrence records1 658

Data sources6

Biological traits0

DNA specimens4

eDNA detections8

Sources6 archives

Databases and archives Erysiphe platani's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 658 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 658 records

Environmental DNA2 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI4 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erysiphe platani has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences10

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV665441.1 ↗384 bpUSA · 2024

ACGT

CAAGGACATGCGTCGGCCGCCCACCGGCTTCGGCTGGAGCGCGTCCGCCAAAGACCCAACCAAAACTCATGTTGTTATTGTCGTCTCAGC …

Erysiphe platani isolate MAP internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type1 658 records

Wild obs. + sensor1 448

Museum / vouchered210

Range

Area of Occupancy AOO4 776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 897≤1 km 82≤10 km 161>10 km 45

1 185 georeferenced · 263 without coordinates

Open the mapobservation + sensor1 448

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 3≤1 km 2≤10 km 29

34 georeferenced · 176 without coordinates

Open the institutions mapphysical evidence210

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Karlsruhe, DE	65
DPIlocation not on record	24
Görlitz, DE	22
WU-MYClocation not on record	10
Auckland, NZ	8
Champaign, US	6
Kew, GB	3
San Sebastián, ES	3
Vancouver, CA	2
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	2
Helsinki, FI	2
Gijón, ES	1
Academy of Sciences of the Republic of Uzbekistanlocation not on record	1
Museo Entomologico de Leonlocation not on record	1
ILLSlocation not on record	1
Leicester, GB	1
GZUlocation not on record	1
Copenhagen, DK	1

18 institutions · 154 of 210 vouchered records shown · 55 without an institution code

09Environmental DNA8 detections

Where the DNA of Erysiphe platani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.40 °C 8.70–16.7

Seasonal swing summer↔winter16.7 °C

Max temp (day)13.2 °C 12.4–20.5

Min temp (night)5.80 °C 5.10–12.2

Precipitation118 mm/mo 81.9–177

Air humidity62.9 % 60.0–63.5

Moisture balance66.3 mm/mo 24.1–66.3

Vapour deficit449 Pa 439–764

Wind speed3.10 m/s 2.90–3.50

Cloud cover41.9 % 37.8–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Erysiphe platani

At a glance

Sources6 archives

At a glance

Record type1 658 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 658 records