Erysiphe pisi

DC. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Erysiphe

At a glance

Occurrence records1 073

Data sources10

Biological traits0

DNA specimens24

eDNA detections27

Sources10 archives

Databases and archives Erysiphe pisi's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 073 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 073 records

Environmental DNA4 datasets · 4 countries27 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceGoaT · NCBI≈69 Mbp

01Narrative

Erysiphe pisi is a plant pathogen that causes powdery mildew on several plant species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erysiphe pisi has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes2

GenBank sequences10

eDNA detections27

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPX277228.1 ↗206 bpIndia · 2025

ACGT

CTTGGTATTCCGAGGGGCGATGTCGCTGTTCGTAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCG …

Erysiphe pisi isolate IIPREp8 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Erysiphe pisi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈69 261 028 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Erysiphe pisi0.07 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 61×GoaT · Wioletta Wieloch 2006

GoaT · Wioletta Wieloch 2006 — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness56.2% BUSCO

08Occurrence & distribution

Record type1 073 records

Wild obs. + sensor525

Museum / vouchered535

Other13

Range

Area of Occupancy AOO3 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 255≤1 km 49≤10 km 159>10 km 8

471 georeferenced · 54 without coordinates

Open the mapobservation + sensor525

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 17≤1 km 60≤10 km 65>10 km 37

179 georeferenced · 356 without coordinates

Open the institutions mapphysical evidence535

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	62
Tartu, EE	53
Karlsruhe, DE	53
Helsinki, FI	47
Uppsala, SE	44
Olocation not on record	42
LDlocation not on record	31
DPIlocation not on record	28
Mlocation not on record	25
Champaign, US	21
Bronx, US	18
Stockholm, SE	13
WU-MYClocation not on record	8
Kuopio, FI	8
Auckland, NZ	7
PHlocation not on record	6
Chapel Hill, US	5
Bernard Price Institute for Palaeontological Researchlocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	4
SLU Artdatabankenlocation not on record	4
Chicago, US	3
Universidade de Lisboa, Museu Bocagelocation not on record	3
Philadelphia, US	2
BDBClocation not on record	2
Norwegian Institute of Bioeconomy Researchlocation not on record	2
UAclocation not on record	1
Laramie, US	1
Lausanne, CH	1
Kew, GB	1
CABI Bioscience Genetic Resource Collectionlocation not on record	1
Catholic University of Pekinglocation not on record	1
Canberra, AU	1
Oskarshamn, SE	1
McWane Science Centerlocation not on record	1

34 institutions · 504 of 535 vouchered records shown · 29 without an institution code

09Environmental DNA27 detections

Where the DNA of Erysiphe pisi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys4

Countries4

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 10.9–19.4

Seasonal swing summer↔winter22.6 °C

Max temp (day)19.7 °C 14.2–24.1

Min temp (night)12.2 °C 7.60–13.9

Precipitation75.0 mm/mo 36.8–93.1

Air humidity61.9 % 51.8–63.7

Moisture balance-14.7 mm/mo -76.8–5.30

Vapour deficit683 Pa 487–1,258

Wind speed3.70 m/s 2.50–4.40

Cloud cover43.8 % 27.7–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Erysiphe pisi

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 073 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 073 records