Erysiphe penicillata

(Wallr.) Link · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Erysiphe

At a glance

Occurrence records439

Data sources7

Biological traits0

DNA specimens1

eDNA detections7

Sources7 archives

Databases and archives Erysiphe penicillata's data was compiled from.

GBIFGlobal Biodiversity Information Facility439 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF439 records

Environmental DNA3 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erysiphe penicillata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN759661.1 ↗631 bpGermany

ACGT

GGTTTCGTAGTGACCTGCGGAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGT …

Erysiphe penicillata isolate K_A20 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS1

fungal barcode

08Occurrence & distribution

Record type439 records

Wild obs. + sensor215

Museum / vouchered223

Other1

Range

Area of Occupancy AOO1 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 33≤1 km 11≤10 km 157>10 km 3

204 georeferenced · 11 without coordinates

Open the mapobservation + sensor215

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 7≤1 km 10≤10 km 22>10 km 1

40 georeferenced · 183 without coordinates

Open the institutions mapphysical evidence223

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	100
Champaign, US	51
Helsinki, FI	18
Tartu, EE	13
Karlsruhe, DE	9
WU-MYClocation not on record	8
Mlocation not on record	2
Logan, US	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Zürich, CH	1
CA	1
Chicago, US	1

13 institutions · 210 of 223 vouchered records shown · 13 without an institution code

09Environmental DNA7 detections

Where the DNA of Erysiphe penicillata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys3

Countries1

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 13.2–13.2

Seasonal swing summer↔winter20.8 °C

Max temp (day)14.2 °C

Min temp (night)12.1 °C

Precipitation70.6 mm/mo

Air humidity62.9 %

Moisture balance-12.6 mm/mo

Vapour deficit562 Pa

Wind speed6.60 m/s

Cloud cover42.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)