Erysiphe necator

Schwein. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Erysiphe

At a glance

Occurrence records607

Data sources10

Biological traits0

DNA specimens137

eDNA detections45

Sources10 archives

Databases and archives Erysiphe necator's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility607 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics137 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF607 records

Environmental DNA3 datasets · 4 countries45 detections

DNA & barcodingBOLD · NCBI137 specimens

Genome at a glanceGoaT · NCBI≈81 Mbp

01Narrative

Uncinula necator (syn. Erysiphe necator) is a fungus that causes powdery mildew of grape. It is a common pathogen of Vitis species, including the wine grape, Vitis vinifera. The fungus is believed to have originated in North America. European varieties of Vitis vinifera are more or less susceptible to this fungus. Uncinula necator infects all green tissue on the grapevine, including leaves and young berries. It can cause crop loss and poor wine quality if untreated. The sexual stage of this pathogen requires free moisture to release ascospores from its cleistothecia in the spring. However, free moisture is not needed for secondary spread via conidia; high atmospheric humidity is sufficient. Its anamorph is called Oidium tuckeri. It produces common odors such as 1-octen-3-one and (Z)-1,5-octadien-3-one. This mildew can be treated with sulfur or fungicides; however resistance to several chemical classes such as Benomyl, the DMIs, and Strobilurins has developed. While synthetic fungicides are often recommended as applications around bloom, it is common to include sulfur in a tank mix to help with resistance management.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding137 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erysiphe necator has left across the world's sequence archives.

At a glance

DNA specimens137

Marker genes3

GenBank sequences10

eDNA detections45

Countries8

The DNA barcodea real sequence read deposited for this species

ITSPV339459.1 ↗305 bpSouth Africa · 2023

ACGT

AGTAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA …

Erysiphe necator isolate K229 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS2

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Erysiphe necator carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈80 917 019 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Erysiphe necator0.08 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness82.4% BUSCO

07Deep time~47.5 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin47.5 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type607 records

Wild obs. + sensor423

Museum / vouchered174

Other10

Range

Area of Occupancy AOO1 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 215≤1 km 26≤10 km 87>10 km 23

351 georeferenced · 72 without coordinates

Open the mapobservation + sensor423

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 5≤1 km 4≤10 km 20>10 km 1

30 georeferenced · 144 without coordinates

Open the institutions mapphysical evidence174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	59
Görlitz, DE	30
Karlsruhe, DE	14
WU-MYClocation not on record	8
Helsinki, FI	8
Zürich, CH	7
Museo Entomologico de Leonlocation not on record	5
Auckland, NZ	4
Kensington, AU	3
Mlocation not on record	2
Academy of Sciences of the Republic of Uzbekistanlocation not on record	2
Kew, GB	2
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	2
Catholic University of Pekinglocation not on record	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
UAclocation not on record	1
University of Tennessee at Chattanoogalocation not on record	1
TENN-Flocation not on record	1
ILLSlocation not on record	1
MeiseBGlocation not on record	1
St. Paul, US	1
Copenhagen, DK	1

22 institutions · 156 of 174 vouchered records shown · 17 without an institution code

09Environmental DNA45 detections

Where the DNA of Erysiphe necator was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys3

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map4 countries0

Treed pine-dwarfshrubs-sphagnum ombrotrophic…Coniferous forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 13.7–18.2

Seasonal swing summer↔winter9.60 °C

Max temp (day)19.2 °C 17.0–22.0

Min temp (night)13.7 °C 9.50–17.1

Precipitation46.3 mm/mo 6.10–78.6

Air humidity62.5 % 58.6–66.4

Moisture balance-60.8 mm/mo -141–-10.7

Vapour deficit697 Pa 616–868

Wind speed4.70 m/s 2.50–6.50

Cloud cover34.9 % 10.6–43.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)