Erysiphe euonymicola

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Erysiphe

At a glance

Occurrence records2 090

Data sources4

Biological traits0

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Erysiphe euonymicola's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 090 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 090 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erysiphe euonymicola has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPP204290.1 ↗478 bpBrazil · 2013

ACGT

CCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGACCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGG …

Erysiphe euonymicola isolate Eo-LIPP-01 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type2 090 records

Wild obs. + sensor2 003

Museum / vouchered87

Range

Area of Occupancy AOO3 772 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 387≤1 km 117≤10 km 178>10 km 42

1 724 georeferenced · 279 without coordinates

Open the mapobservation + sensor2 003

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 1≤10 km 8

9 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	17
Helsinki, FI	17
Auckland, NZ	16
WU-MYClocation not on record	10
Zürich, CH	5
Karlsruhe, DE	4
San Sebastián, ES	2
Copenhagen, DK	1
Academy of Sciences of the Republic of Uzbekistanlocation not on record	1
TENN-Flocation not on record	1
Kew, GB	1
Chicago, US	1

12 institutions · 76 of 87 vouchered records shown · 11 without an institution code

At a glance

Sources4 archives

At a glance

Record type2 090 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 12 geolocated

Record type2 090 records