Erysiphe convolvuli

DC. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Erysiphe

At a glance

Occurrence records1 625

Data sources8

Biological traits0

DNA specimens11

eDNA detections18

Sources8 archives

Databases and archives Erysiphe convolvuli's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 625 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 625 records

Environmental DNA2 datasets · 4 countries18 detections

DNA & barcodingBOLD · NCBI11 specimens

01Narrative

Erysiphe convolvuli is een echte meeldauw die behoort tot de familie Erysiphaceae. Deze biotrofe parasiet komt voor op planten uit de windefamilie. De soort kent meerdere variëteiten, zoals: - Erysiphe convolvuli var. convolvuli(Akkerwindemeeldauw) - Erysiphe convolvuli var. calystegiae (Haagwindemeeldauw)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erysiphe convolvuli has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes2

GenBank sequences10

eDNA detections18

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPV942340.1 ↗541 bpChina · 2025

ACGT

TTGCTTTGGCGGGCCGGGCCGTGTCGTCGCTGCCCGCATGGGCATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGTGCCCGCCAAAGA …

Erysiphe convolvuli voucher ChPM-ZL internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type1 625 records

Wild obs. + sensor1 371

Museum / vouchered245

Other9

Range

Area of Occupancy AOO4 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 807≤1 km 75≤10 km 199>10 km 34

1 115 georeferenced · 256 without coordinates

Open the mapobservation + sensor1 371

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 6≤1 km 39≤10 km 18>10 km 13

76 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence245

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mlocation not on record	49
Helsinki, FI	28
Karlsruhe, DE	24
MAlocation not on record	24
Görlitz, DE	16
Uppsala, SE	15
WU-MYClocation not on record	11
Tartu, EE	8
Kew, GB	5
Bernard Price Institute for Palaeontological Researchlocation not on record	5
DPIlocation not on record	4
CA	3
Stockholm, SE	3
IFR-DNFlocation not on record	3
Pullman, US	2
SLU Artdatabankenlocation not on record	2
Chicago, US	2
Museo Entomologico de Leonlocation not on record	2
TROMlocation not on record	2
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	2
GJOlocation not on record	1
MeiseBGlocation not on record	1
Olocation not on record	1
California State University, East Baylocation not on record	1
Toronto, CA	1
Canberra, AU	1
Madison, US	1
San Sebastián, ES	1
Nurata nature reservelocation not on record	1
Göteborg, SE	1
Uniwersytet Jagiellońskilocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

32 institutions · 222 of 245 vouchered records shown · 22 without an institution code

09Environmental DNA18 detections

Where the DNA of Erysiphe convolvuli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys2

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map4 countries0

Other Urban/disturbed/developed

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 10.7–22.0

Seasonal swing summer↔winter27.5 °C

Max temp (day)17.4 °C 14.8–27.6

Min temp (night)9.50 °C 7.40–13.9

Precipitation34.1 mm/mo 5.50–59.2

Air humidity58.5 % 50.9–62.8

Moisture balance-29.3 mm/mo -133–-4.10

Vapour deficit569 Pa 532–1,459

Wind speed3.80 m/s 3.10–4.80

Cloud cover37.9 % 21.6–50.3

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Erysiphe convolvuli

At a glance

Sources8 archives

At a glance

Record type1 625 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 625 records