Erysiphe betae

(Vaňha) Weltzien · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Erysiphe

At a glance

Occurrence records292

Data sources10

Biological traits0

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Erysiphe betae's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility290 records↗

OBISOcean Biodiversity Information System2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS292 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Erysiphe betae is a plant pathogen. It is a form of powdery mildew that can affect crops of sugar beet, when it can cause up to a 30% yield loss.Heffer, V., M. L. Powelson, K. B. Johnson, and N. Shishkoff. "Identification of Powdery Mildew Fungi anno 2006." Identification of Powdery Mildew Fungi. APS, 2006. Web. 14 Nov. 2016.<http://www.apsnet.org/zedcenter/intropp/LabExercises/Pages/PowderyMildew.aspx> The fungus occurs worldwide in all regions where sugar beet is grown and it also infects other edible crops, e.g. beetroot.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erysiphe betae has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences10

eDNA detections4

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPP968456.1 ↗560 bpChina

ACGT

CAGAGTGCGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCG …

Erysiphe betae voucher HMAS-38976 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type292 records

Wild obs. + sensor225

Museum / vouchered67

Origin

Native2

Range

Area of Occupancy AOO920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 29≤1 km 141≤10 km 42>10 km 1

213 georeferenced · 12 without coordinates

Open the mapobservation + sensor225

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 7≤1 km 4≤10 km 9

20 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	13
Mlocation not on record	8
DPIlocation not on record	8
Görlitz, DE	6
University of Tennessee at Chattanoogalocation not on record	6
Logan, US	3
Kew, GB	3
Karlsruhe, DE	3
Auckland, NZ	3
WU-MYClocation not on record	3
TENN-Flocation not on record	1
Bronx, US	1
Tartu, EE	1
Museo Entomologico de Leonlocation not on record	1
MeiseBGlocation not on record	1
Uppsala, SE	1

16 institutions · 62 of 67 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Erysiphe betae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 22.0–22.0

Seasonal swing summer↔winter27.8 °C

Max temp (day)27.6 °C

Min temp (night)13.9 °C

Precipitation5.50 mm/mo

Air humidity39.8 %

Moisture balance-124 mm/mo

Vapour deficit1,940 Pa

Wind speed2.40 m/s

Cloud cover21.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)