Erynnis tristis

(Boisduval, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Erynnis

At a glance

Occurrence records6 166

Data sources7

Biological traits0

DNA specimens35

eDNA detections67

Sources7 archives

Databases and archives Erynnis tristis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 166 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI67 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 166 records

Environmental DNA1 datasets · 3 countries67 detections

DNA & barcodingBOLD35 specimens

01Narrative

Erynnis tristis, the mournful duskywing, is a species of spread-wing skipper in the butterfly family Hesperiidae. It is found in Central America, North America, and South America. It is mottled brown with a white fringe on the hind wings. It appears similar to the funereal duskywing, but the mournful duskywing is more likely to appear in urban areas. The larva feed on young oaks while adults nectar from a variety of wild and garden flowers. The MONA or Hodges number for Erynnis tristis is 3953. Mournful duskywing, Erynnis tristis

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erynnis tristis has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections67

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

391Tmostly conserved

433Gmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCGGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes6

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Erynnis telemachussame genus4.3%Erynnis meridianussame genus4.6%Erynnis horatiussame genus4.6%Erynnis juvenalissame genus5.3%Erynnis propertiussame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 166 records

Wild obs. + sensor6 008

Museum / vouchered158

Range

Area of Occupancy AOO9 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 2 996≤1 km 1 200≤10 km 353>10 km 312

4 861 georeferenced · 1 147 without coordinates

Open the mapobservation + sensor6 008

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 1≤1 km 35≤10 km 73>10 km 29

138 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence158

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	73
US	21
Santa Cruz, US	16
East Lansing, US	12
Philadelphia, US	9
OSUClocation not on record	6
Helsinki, FI	4
National Biodiversity Institute, Costa Ricalocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Tartu, EE	2
Albuquerque, US	2
University of Pennsylvanialocation not on record	2
US	1
St. Paul, US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
University of Central Floridalocation not on record	1

16 institutions · 158 of 158 vouchered records shown

09Environmental DNA67 detections

Where the DNA of Erynnis tristis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found67

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 67 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 17.3–26.2

Seasonal swing summer↔winter3.30 °C

Max temp (day)29.3 °C 24.8–30.2

Min temp (night)22.5 °C 11.9–23.4

Precipitation50.1 mm/mo 4.90–404

Air humidity60.7 % 51.9–69.0

Moisture balance-103 mm/mo -170–264

Vapour deficit1,065 Pa 878–1,373

Wind speed2.50 m/s 1.00–5.10

Cloud cover27.4 % 13.3–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Erynnis tristis

At a glance

Sources7 archives

At a glance

Record type6 166 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 166 records