Erygia apicalis

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Erygia

At a glance

Occurrence records866

Data sources7

Biological traits0

DNA specimens73

eDNA detections77

Sources7 archives

Databases and archives Erygia apicalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility866 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics73 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF866 records

Environmental DNA1 datasets · 8 countries77 detections

DNA & barcodingBOLD73 specimens

01Narrative

Erygia apicalis is a moth of the family Erebidae first described by Achille Guenée in 1852.Lepidopterorum Catalogus It is found from the Indo-Australian tropics of India, Sri Lanka to Japan, Australia (where it has been recorded from the Northern Territory, Queensland and New South Wales) and the Solomon Islands. The habitat consists of lowland areas, including dry heath forests and softwood plantations.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding73 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erygia apicalis has left across the world's sequence archives.

At a glance

DNA specimens73

BINs3

Marker genes3

eDNA detections77

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus69 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

82Cmostly conserved

88Cmostly conserved

139Tmostly conserved

169Amostly conserved

202Cmostly conserved

206Tmostly conserved

220Tmostly conserved

238Tmostly conserved

340Cmostly conserved

352Tmostly conserved

364Cmostly conserved

379Tmostly conserved

400Cmostly conserved

406Cmostly conserved

407Tmostly conserved

415Tmostly conserved

514Amostly conserved

547Tmostly conserved

562Tmostly conserved

581Cmostly conserved

616Cmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes4

BINs3

Most divergent pair2.7%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Prorocopis transversilineasame family5.8%Ecphysis robiginosasame family5.9%Achaea atrimaculasame family6.1%Grammodes pulcherrimasame family6.2%Grammodes bifasciatasame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type866 records

Wild obs. + sensor512

Museum / vouchered354

Range

Area of Occupancy AOO1 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 197≤1 km 89≤10 km 20>10 km 32

338 georeferenced · 174 without coordinates

Open the mapobservation + sensor512

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 48>10 km 1

49 georeferenced · 305 without coordinates

Open the institutions mapphysical evidence354

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	83
Chiba, JP	58
Hiwa Museum of Natural Historylocation not on record	47
Gifu prefectural Museumlocation not on record	37
Helsinki, FI	27
FACTlocation not on record	24
Taiwan Forestry Research Institutelocation not on record	23
NSMKlocation not on record	11
Toyota city nature sanctuarylocation not on record	10
JP	8
Kawasaki Shi Tama Ku, JP	6
KOMlocation not on record	4
Sagamihara, JP	4
Iwate Prefectural Museumlocation not on record	2
HUNMlocation not on record	2
Tallinn, EE	1
Research Collection of Egbert Friedrichlocation not on record	1
MZLUlocation not on record	1
Itami Shi, JP	1
Shiojiri City Museum of Natural Historylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

21 institutions · 352 of 354 vouchered records shown · 2 without an institution code

09Environmental DNA77 detections

Where the DNA of Erygia apicalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map8 countries0

1. Forest & Woodland | 1.9. Subtropical/Trop…Dry Sclerophyll Forest1. Forest & Woodland|1.9. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 19.8–24.9

Seasonal swing summer↔winter8.60 °C

Max temp (day)24.7 °C 23.6–28.2

Min temp (night)20.9 °C 14.7–22.1

Precipitation169 mm/mo 102–277

Air humidity62.0 % 61.5–67.6

Vapour deficit1,033 Pa 899–1,096

Cloud cover31.0 % 26.5–64.1

CHELSA 1981–2010, ~9 km grid, at location & month of 75 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)