Erronea ovum

(Gmelin, 1791) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Cypraeidae/Erronea

At a glance

Occurrence records330

Data sources9

Biological traits2

DNA specimens9

eDNA detections9

Sources9 archives

Databases and archives Erronea ovum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility184 records↗

OBISOcean Biodiversity Information System146 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS330 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Erronea ovum, common name the egg cowry, is a species of sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erronea ovum has left across the world's sequence archives.

At a glance

DNA specimens9

BINs4

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P312 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)4.3%

Haplotypes2

BINs4

Most divergent pair0.32%

Where individuals differ — all 28 variable positions, in barcode order

3Avariable

27Avariable

39Tvariable

42Avariable

55Tvariable

70Gmostly conserved

96Tvariable

114Tvariable

135Gvariable

144Avariable

150Cvariable

153Tvariable

154Cvariable

156Cvariable

177Tmostly conserved

180Tmostly conserved

183Cvariable

201Avariable

202Tvariable

210Gmostly conserved

213Amostly conserved

228Gvariable

235Tvariable

255Tvariable

258Tvariable

261Tvariable

270Cvariable

276Gvariable

TTAGCAGGAAATCTTGCACATGCAGGAGGATCTGTTGATCTAGCTATTTTTTCATTACATCTTGCAGGTGTTTCTTCTATTTTAGGTGCA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type330 records

Wild obs. + sensor25

Museum / vouchered305

Range

Area of Occupancy AOO716 km²

Depth

0–200 m sunlit12

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 12 m · 12 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 6≤1 km 7≤10 km 5>10 km 1

19 georeferenced · 6 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 2≤1 km 38≤10 km 44>10 km 42

126 georeferenced · 179 without coordinates

Open the institutions mapphysical evidence305

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	64
Cambridge, US	15
Western Australian Museumlocation not on record	15
Natural History Museum Rotterdamlocation not on record	13
Museums Victorialocation not on record	9
Museum and Art Gallery of the Northern Territorylocation not on record	8
Denver, US	7
Natick, US	7
Brussels, BE	6
RBINS-Scientific Heritagelocation not on record	4
Santa Barbara Museum of Natural Historylocation not on record	3
Salzburg, AT	2
Auckland, NZ	2
CASlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
NTNU-VMlocation not on record	1
Paris, FR	1
Paleontological Research Institutionlocation not on record	1

18 institutions · 160 of 305 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Erronea ovum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)