Erodium botrys
(Cav.) Bertol. · speciesAt a glance
Occurrence records18 314
Data sources9
Biological traits126
DNA specimens6
eDNA detections4
Sources9 archives
Databases and archives Erodium botrys's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility18 314 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics6 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources126 traits
Occurrence & distributionGBIF18 314 records
Environmental DNA1 datasets · 2 countries4 detections
DNA & barcodingBOLD · NCBI6 specimens
Genome at a glanceCCDB2n = 40
01Narrative
L'Érodium en grappe ou Bec-de-grue en grappe est une espèce de plantes de la famille des Géraniacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology15
Fruit length10 mm
Leaf length100 mm
Leaf length max140 mm
Leaf length min20 mm
Leaf mass per area61.17 g/m2
Leaf width30 mm
⚠ sources differ — AusTraits: 30 mm · GIFT: 28 mm
Leaf width max40 mm
Leaf width min8 mm
Petiole length7.5 cm
Plant height0.24 m
⚠ sources differ — GIFT: 0.24 m · AusTraits: 0.2 m · USDA: 0.244 m · TRY: 0.09 m
Plant height max0.6 m
Plant height min0.01 m
Seed mass11.67 mg
⚠ sources differ — TRY: 11.67 mg · GIFT: 6.06 mg
Seed mass max23.47 mg
Seed mass min5.6 mg
Life cycle & reproduction32
After harvest regrowth rateModerate
Bloom periodEarly Spring
Coppice potentialNo
Deciduousnessdeciduous
Flower colourpink
⚠ sources differ — GIFT: pink · USDA: Purple
Flower conspicuousYes
Flower length max14 mm
Flower length min8 mm
Flowering endDec
Flowering startAug
Flowering timennnnnnnyyyyy
Fruit seed period beginSpring
Fruit seed period endSpring
Growth rate USDARapid
Life formannual
Life spanannual
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Resprout abilityNo
Resprouting capacityfire_killed
Seed spread rateRapid
Seedling vigorHigh
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment32
Active growth periodFall, Winter and Spring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatLow
Climatesubtropical
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typemericarp
Growth formherb
Growth form USDASingle Crown
Habitat GIFTLowland
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf formoblong
Leaf retentionNo
Leaf shapenarrowly_elliptical oblong
Low growing grassNo
Root depth min12 in
Shape and orientationProstrate
Small grainNo
Woodinessnon-woody
Physiology & chemistry24
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min240 days
Leaf n17.65 mg/g
Leaf p2.1 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max24 in
Precipitation min12 in
Protein potentialHigh
Salinity toleranceLow
Shade toleranceHigh
Soil pH max7.6 pH
Soil pH min5.6 pH
Specific leaf area (SLA)13.91 mm²/mg
Temperature min17 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound850 000 per lb
ToxicityNone
Veneer productNo
Other traits7
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceNo
Shoot length max40 cm
Shoot length min8 cm
Shoot orientationascending
05DNA & barcoding6 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erodium botrys has left across the world's sequence archives.
At a glance
DNA specimens6
Marker genes5
GenBank sequences4
eDNA detections4
Countries2
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCGATCCGTCGCCCCG …
Erodium botrys voucher PLT.0544 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcLa★trnL-F★ITS4★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Erodium botrys carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidydiploid inferred
Chromosome records18–602n range40median40mode52records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4026×CCDB · iber-fl · CCDB · nw-europe-fl · CCDB · fl-europaea +8
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal, XIII. Alves, M. C. & M. T. Leitao.Bol. Soc. Brot. ser. 250: 231-245(1976).
CCDB · iber-fl — Contribution l'tude caryosystmatique du genre Erodium L'Hr. II Guittonneau, G.Bull. Soc. Bot. France112: 25-32(1965).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 382-393. Luque, T. & J. A. Devesa.Lagascalia13(2): 303-307(1985).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3201
CCDB · fl-europaea — Guittonneau, 1965
CCDB · book-ipcn65 — Guittonneau 1965b
CCDB · ipcn-api-dl — Luque, T. & J. A. Devesa. 1985. Números 382-393. In Números cromosómicos para la flora española. 363-434. Lagascalia 13: 303–307.
CCDB · ipcn-api-dl — Venter, H. J. T. & R. L. Verhoeven. 1990. The genus Erodium in southern Africa. S. African J. Bot. 56: 79–92.
CCDB · ipcn-api-dl — Dahlgren, G. 1980. Cytological and morphologicai investigation of the genus Erodium L'Her. in the Aegean. Bot. Not. 133: 491–514.
CCDB · ipcn-api-dl — ALVES, M. C. & M. T. LEITAO. 1976. Contribuciao para o conhecimento citotaxonomico das spematophyta de Portugal. XIII. Geraniaceae. Bol. Soc. Brot., sér. 2 50: 231–245.
CCDB · book-ipcn67-71 — BORGEN L. 1970. Chromosome numbers of Macaronesian flowering plants. Nytt Mag. Bot. 17: 145-161.
CCDB · book-ipcn67-71 — GUITTONNEAU, G. 1967. Contribution a l'etude caryosysternatique du genre Erodiurn L'Herit IV. Bull. Soc. Bot. France 114: 32-41.
CCDB · book-ipcn75-78 — Alves & Leitao 1976
CCDB · book-ipcn73-74 — GUITTONNEQU, G.-G. 1972. Contribution a l'etude biosystematique du genre Erodium L'H6r. dans le bassin m8dit8rran6en occidental. Boissiera 20: 1 154.
CCDB · book-fedorov — Heiser, Whitaker 1948
CCDB · book-atlas-flowering-plants — Heiser & W. 1948
CCDB · CromoCat 2015 — Alves, M. C. & Leitao, M. T. (1976). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal, XIII. Bol. Soc. Brot. 50: 231-245.
CCDB · CromoCat 2015 — Borgen, L. (1970). Chromosome numbers of Macaronesian flowering plants. Nytt Mag. Bot. 17: 145-164.
CCDB · CromoCat 2015 — Dahlgren, G. (1980). Cytological and morphological investigation of the genus Erodium L'Hér. in the Aegean. Bot. Not. 133: 491-514.
CCDB · CromoCat 2015 — Guittonneau, G. (1965a). Contribution à l'étude caryosystématique du genre Erodium L'Hér. II. Bull. Soc. Bot. France 112: 25-32.
CCDB · CromoCat 2015 — Guittonneau, G. (1967). Contribution à l'etude caryosystématique du genre Erodium L'Hér. IV. Bull. Soc. Bot. France 114: 32-41.
CCDB · CromoCat 2015 — Guittonneau, G. (1972). Contribution à l'etude biosystématique du genre Erodium L'Hér. dans le bassin Méditérranéen occidental. Boissiera 20: 5-154.
CCDB · CromoCat 2015 — Heiser, C. B. & Whitaker, T. W. (1948). Chromosome number, polyploidy and growth habit in California weeds. Amer. J. Bot. 35(3): 179-186.
CCDB · CromoCat 2015 — Luque, T. & Devesa, J. A. (1985). Números cromosómicos para la flora española, 382-393. Lagascalia 13(2): 303-307.
2n 1815×CCDB · iber-fl · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +4
CCDB · iber-fl — Contribution l'tude caryosystmatique du genre Erodium L'Hr. II Guittonneau, G.Bull. Soc. Bot. France112: 25-32(1965).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 382-393. Luque, T. & J. A. Devesa.Lagascalia13(2): 303-307(1985).
CCDB · book-ipcn65 — Guittonneau 1965a, b
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.
CCDB · book-ipcn67-71 — GUITTONNEAU, G. 1967. Contribution a l'etude caryosysternatique du genre Erodiurn L'Herit IV. Bull. Soc. Bot. France 114: 32-41.
CCDB · book-indian_vol1 — Gauger, W. 1937 ; Guittonneau, G. 1964, 1965, 1967
CCDB · book-atlas-flowering-plants — Gauger 1937
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Gauger, W. (1937). Ergebnisse einer zytologischen Untersuchung der Familie der Geraniaceae. I. Planta 26: 529-531.
CCDB · CromoCat 2015 — Guittonneau, G. (1964). Contribution à l'étude caryologique du genre Erodium L'Hér. I. Bull. Soc. Bot. France 111: 2-4.
CCDB · CromoCat 2015 — Guittonneau, G. (1965a). Contribution à l'étude caryosystématique du genre Erodium L'Hér. II. Bull. Soc. Bot. France 112: 25-32.
CCDB · CromoCat 2015 — Guittonneau, G. (1967). Contribution à l'etude caryosystématique du genre Erodium L'Hér. IV. Bull. Soc. Bot. France 114: 32-41.
CCDB · CromoCat 2015 — Guittonneau, G. (1975). Contribution à l'étude caryosystématique et phylogénétique des Géraniacées dans...Colloques Int. Colloques Intern. CNRS 195-205.
CCDB · CromoCat 2015 — Luque, T. & Devesa, J. A. (1985). Números cromosómicos para la flora española, 382-393. Lagascalia 13(2): 303-307.
2n 208×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +2
CCDB · ipcn-api-dl — Badr, A. & M. A. Hamoud. 1985. The karyotypes of two species of Asphodelus L. Liliaceae and five species of Erodium L'Hèrit. Geraniaceae. Egypt. J. Bot. 28: 145–148.
CCDB · ipcn-api-dl — Malallah, G. A., M. Masood & M. Al-Dosari. 2001. Chromosome numbers of the Kuwaiti flora, III. Willdenowia 31: 411–418.
CCDB · book-ipcn67-71 — VAN LOON, J.C., T.W.J. GADELLA, & E. KLIPHUIS. 1971. Cytological studies in some flowering plants from Southern France. Acta Bot. Neerl. 20: 157-166.
CCDB · book-indian_vol1 — Warburg, E.F. 1938b ; Van Loon, J.C. et al. 1971
CCDB · book-atlas-flowering-plants — Warburg 1938
CCDB · CromoCat 2015 — Loon van, J. C., Gadella, Th. W. J. & Kliphuis, E. (1971). Cytological studies in some flowering plants from Southern France. Acta Bot. Neerl. 20: 157-166.
CCDB · CromoCat 2015 — Warburg, E. F. (1938). Taxonomy and relationships in the Geraniales in the light of their cytology. New Phytol. 37: 130-159, 189-210.
CCDB · CromoCat 2015 — Malallah, G. A., Masood, M. & Al-Dosari, M. (2001). Chromosome numbers of the Kuwaiti flora, III Willdenowia 31: 411–418
2n 602×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.
CCDB · CromoCat 2015 — Díaz Lifante, Z., Luque, T. & Santa Bárbara, C. (1992). Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229-250.
2n 361×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Guittonneau, G. (1965b). Note sur la découverte de la polysomatie dans le genre Erodium L'Hér. Compt. Rend. Acad. Sci. Paris 260: 5332-5335.
n 102×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Malallah, G. A., M. Masood & M. Al-Dosari. 2001. Chromosome numbers of the Kuwaiti flora, III. Willdenowia 31: 411–418.
CCDB · CromoCat 2015 — Malallah, G. A., Masood, M. & Al-Dosari, M. (2001). Chromosome numbers of the Kuwaiti flora, III Willdenowia 31: 411–418
n 91×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Guittonneau, G. (1964). Contribution à l'étude caryologique du genre Erodium L'Hér. I. Bull. Soc. Bot. France 111: 2-4.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type18 314 records
Wild obs. + sensor15 828
Museum / vouchered2 448
Other38
Origin
Native104
Introduced3 214
Range
Area of Occupancy AOO33 736 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy86% within 1 km
≤100 m 8 916≤1 km 2 370≤10 km 1 501>10 km 312
13 099 georeferenced · 2 729 without coordinates
Open the mapobservation + sensor15 828
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy58% within 1 km
≤100 m 254≤1 km 450≤10 km 484>10 km 21
1 209 georeferenced · 1 239 without coordinates
Open the institutions mapphysical evidence2 448
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions78 of 120 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Adelaide, AU | 242 |
| San Diego, US | 208 |
| Claremont, US | 135 |
| Riverside, US | 124 |
| Kensington, AU | 83 |
| MAlocation not on record | 82 |
| Museo Entomologico de Leonlocation not on record | 79 |
| BIO-UNIPIlocation not on record | 75 |
| CICYTEXlocation not on record | 72 |
| Paris, FR | 67 |
| LDlocation not on record | 62 |
| Badajoz, ES | 59 |
| Canberra, AU | 57 |
| Davis, US | 53 |
| Entomological Society of Latvialocation not on record | 39 |
| Mount Annan, AU | 39 |
| Canadian Department of Agriculturelocation not on record | 38 |
| ISAlocation not on record | 33 |
| US | 28 |
| Santa Barbara, US | 26 |
| Hobart, AU | 26 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 25 |
| Berlin, DE | 25 |
| Tempe, US | 23 |
| San Luis Obispo, US | 21 |
| College of the Atlantic, Museumlocation not on record | 21 |
| València, ES | 21 |
| Arcata, US | 20 |
| Salamanca, ES | 20 |
| MeiseBGlocation not on record | 18 |
| Severin-McDaniel Insect Collectionlocation not on record | 18 |
| Irvine, US | 17 |
| Madrid, ES | 16 |
| BClocation not on record | 15 |
| Pretoria, ZA | 13 |
| EL PASO, US | 13 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 13 |
| Barcelona, ES | 12 |
| Turlock, US | 12 |
| Museo Achille Folettolocation not on record | 11 |
| Los Angeles, US | 11 |
| UChlocation not on record | 11 |
| CJBGlocation not on record | 11 |
| Corvallis, US | 11 |
| Angwin, US | 9 |
| RABATlocation not on record | 9 |
| Córdoba, ES | 9 |
| BDBClocation not on record | 8 |
| CASlocation not on record | 8 |
| Alicante, ES | 7 |
| Northridge, US | 7 |
| Vitoria, ES | 7 |
| Granada, ES | 7 |
| San Bernardino, US | 7 |
| Cape Town, ZA | 6 |
| San Jose, US | 6 |
| Wlocation not on record | 6 |
| Saint Louis, US | 6 |
| Brisbane, AU | 6 |
| Tokushima, JP | 5 |
| Long Beach, US | 5 |
| Boise, US | 4 |
| Mexico City, MX | 4 |
| WTUlocation not on record | 4 |
| Armidale, AU | 4 |
| Christchurch, NZ | 4 |
| Odawara, JP | 4 |
| Olocation not on record | 4 |
| South Kensington, GB | 4 |
| Bern, CH | 4 |
| Uppsala, SE | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Palmerston, AU | 3 |
| Valparaiso, CL | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Omachi Alpine Museumlocation not on record | 3 |
| Coimbra, PT | 3 |
| Frankfurt am Main | 2 |
| Auckland, NZ | 2 |
| Parkville, AU | 2 |
| Bureau of Land Management, Medford District Officelocation not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Santa Cruz, US | 2 |
| Bronx, US | 2 |
| BGPAlocation not on record | 2 |
| Oskarshamn, SE | 2 |
| Wuzhou, CN | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Honolulu, US | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| San Sebastián, ES | 1 |
| Jaén, ES | 1 |
| Bourges, FR | 1 |
| Fullerton, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Pamplona, ES | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Portland, US | 1 |
| Moscow, US | 1 |
| MSB-3054location not on record | 1 |
| Kew, GB | 1 |
| BG-NMNHSlocation not on record | 1 |
| Chicago, US | 1 |
| Tampa, US | 1 |
| Madison, US | 1 |
| ASUlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Mexico City, MX | 1 |
| Austin, US | 1 |
| Valparaíso, CL | 1 |
| CIBIOlocation not on record | 1 |
| Sevilla, ES | 1 |
| Caldwell, US | 1 |
| Smithfield, AU | 1 |
| Nunoa, Santiago, CL | 1 |
| QVMAGlocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| Provo, US | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
120 institutions · 2 232 of 2 448 vouchered records shown · 213 without an institution code
09Environmental DNA4 detections
Where the DNA of Erodium botrys was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map2 countries0
Ruderal/Coastal Sage Scrub with Artemisia ca…Chaparral
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 15.0–18.7
Seasonal swing summer↔winter10.9 °C
Max temp (day)20.2 °C 20.0–24.2
Min temp (night)10.8 °C 10.5–12.3
Precipitation26.0 mm/mo 21.1–32.1
Air humidity60.9 % 54.8–61.0
Moisture balance-100 mm/mo -119–-94.8
Vapour deficit677 Pa 669–990
Wind speed2.30 m/s 1.80–2.40
Cloud cover31.7 % 27.8–34.6
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.