Erodiophyllum elderi

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Erodiophyllum

At a glance

Occurrence records243

Data sources9

Biological traits33

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Erodiophyllum elderi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF243 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Erodiophyllum elderi là một loài thực vật có hoa trong họ Cúc. Loài này được F.Muell. mô tả khoa học đầu tiên năm 1875.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsGIFTTRY

Size & morphology13

Fruit length3 mm

Leaf length70 mm

Leaf length max100 mm

Leaf length min40 mm

Leaf width25 mm

Leaf width max30 mm

Leaf width min20 mm

Plant height0.3 m

Plant height max0.5 m

Plant height min0.15 m

Seed length3.73 mm

Seed mass1 245 mg

Seed width1.85 mm

Life cycle & reproduction7

Dehiscenceindehiscent

Dispersal typewind

Flowering timennnnnnnnyyyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapeoblanceolate oblong

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition7 compounds

Compounds documented for Erodiophyllum elderi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols2

Fatty alcohols2

Oxygenated hydrocarbons2

Purine alkaloids1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(8S)-heptadec-16-en-4,6-diyn-8-ol	present	LOTUS
10-Hydroxy-4,6-decadiyn-3-one	present	LOTUS
7-Methyl-1,3-bis(3-methylbut-2-enyl)purine-2,6-dione	present	NPASS
Combretol	present	NPASS
Heptadeca-9,16-dien-4,6-diyn-8-one	present	LOTUS
Pachypodol	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erodiophyllum elderi has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX257474.1 ↗705 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTATAACAACCATGCCAGTATGG …

Erodiophyllum elderi isolate Erodiophyllum_elderi_14C small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Erodiophyllum elderi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Watanabe, K., P. S. Short, T. Denda, Y. Suzuki, M. Ito, T. Yahara & K. Kosuge. 1996. Chromosome number determinations in the Australian Astereae (Asteraceae). Muelleria 9: 197–228.

CCDB · ipcn-api-dl — Watanabe, K., T. Yahara, T. Denda & K. Kosuge. 1999. Chromosomal evolution in the genus Brachyscome (Asteraceae, Astereae): statistical tests regarding correlation between changes in karyotype and habit using phylogenetic information. J. Pl. Res. 112: 145–161.

08Occurrence & distribution

Record type243 records

Wild obs. + sensor62

Museum / vouchered175

Cultivated / captive6

Origin

Native63

Range

Area of Occupancy AOO616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 46≤1 km 8≤10 km 4>10 km 3

61 georeferenced · 1 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 15≤1 km 34≤10 km 64>10 km 55

168 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence175

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced · 1 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	105
Canberra, AU	22
Mount Annan, AU	15
Museo Entomologico de Leonlocation not on record	10
Kensington, AU	6
EL PASO, US	2
Stockholm, SE	2
John T. Waterhouse Herbariumlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Palmerston, AU	1
Armidale, AU	1

11 institutions · 166 of 175 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Erodiophyllum elderi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)