Eristalis gatesi

Thompson, 1997 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Eristalis

At a glance

Occurrence records214

Data sources7

Biological traits0

DNA specimens12

eDNA detections11

Sources7 archives

Databases and archives Eristalis gatesi's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility214 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF214 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD12 specimens

01Narrative

Bill Gates' flower fly (Eristalis gatesi) is a flower fly endemic to Costa Rica named after Bill Gates. Another fly found in similar habitats was named after Gates' associate Paul Allen, called Paul Allen's flower fly (Eristalis alleni); according to Chris Thompson, the describer of these species, both names were in "recognition of [their] great contributions to the science of Dipterology".

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eristalis gatesi has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACTTTATATTTTGTATTTGGAACATGAGCAGGTATAGTAGGAACTTCATTAAGAATTTTAATTCGAGCTGAACTAGGTCACCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eristalis gomojunovaesame genus4.1%Eristalis alpinasame genus4.3%Eristalis circesame genus4.4%Eristalis obscurasame genus4.7%Eristalis rupiumsame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type214 records

Wild obs. + sensor6

Museum / vouchered208

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 3≤1 km 1≤10 km 2

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 208 records without

Open the institutions mapphysical evidence208

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	206
Wuzhou, CN	1
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	1

3 institutions · 208 of 208 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Eristalis gatesi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 6.20–16.3

Seasonal swing summer↔winter2.00 °C

Max temp (day)18.1 °C 10.0–20.6

Min temp (night)11.1 °C 3.10–12.6

Precipitation266 mm/mo 129–522

Air humidity66.1 % 58.7–71.2

Moisture balance138 mm/mo 13.2–423

Vapour deficit518 Pa 377–602

Wind speed1.50 m/s 1.10–4.90

Cloud cover29.4 % 14.9–46.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)