Eriphia verrucosa

(Forskål, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Eriphiidae/Eriphia

At a glance

Occurrence records5 554

Data sources12

Biological traits4

DNA specimens52

eDNA detections52

Sources12 archives

Databases and archives Eriphia verrucosa's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 220 records↗

OBISOcean Biodiversity Information System334 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS5 554 records

Environmental DNA1 datasets · 4 countries52 detections

DNA & barcodingBOLD52 specimens

Genome at a glanceGoaT · NCBI≈1.3 Gbp

01Narrative

Exemplar in defense position underwater. Eriphia verrucosa, sometimes called the warty crab or yellow crab, is a species of crab found in the Black Sea, Mediterranean Sea and eastern Atlantic Ocean from Brittany to Mauritania and the Azores. Individual crabs have been caught as far north as Cornwall. Formerly a frequent species in the Black Sea, it has decreased in numbers since the 1980s and is now listed in the Ukrainian Red Data Book of endangered species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length8 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importanceminor commercial

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriphia verrucosa has left across the world's sequence archives.

At a glance

DNA specimens52

BINs1

Marker genes3

eDNA detections52

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P453 bp consensus49 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

148Tmostly conserved

154Cmostly conserved

211Cmostly conserved

217Cvariable

226Amostly conserved

256Cmostly conserved

274Amostly conserved

361Gmostly conserved

444Tmostly conserved

ATTAGGTCAACCAGGTACCCTAATTGGTAACGATCAAATTTATAATGTTGTAGTAACTGCCCATGCTTTTGTAATAATTTTCTTTATAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.99%

Haplotypes32

BIN1

Most divergent pair9.9%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Carpilius convexussame order11.9%Carpilius maculatussame order12.6%Trapezia septatasame order12.6%Leptodius sanguineussame order13.5%Etisus demanisame order13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Eriphia verrucosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 277 802 017 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Eriphia verrucosa1.28 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type5 554 records

Wild obs. + sensor5 123

Museum / vouchered263

Other168

Origin

Native259

Range

Area of Occupancy AOO9 048 km²

Depth

0–200 m sunlit72

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 0 m · max 719 m · 73 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 2 035≤1 km 1 207≤10 km 292>10 km 191

3 725 georeferenced · 1 398 without coordinates

Open the mapobservation + sensor5 123

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 1≤1 km 26≤10 km 5>10 km 9

41 georeferenced · 222 without coordinates

Open the institutions mapphysical evidence263

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ICM-CSIClocation not on record	61
Istituto Superiore per la Protezione e la Ricerca Ambientalelocation not on record	24
Washington, US	23
AUTHlocation not on record	20
Brussels, BE	11
Frankfurt am Main	11
Paris, FR	6
IPMAlocation not on record	6
IEO-COMA-CSIClocation not on record	5
Museum für Naturkunde Berlin (Zoological Collections)location not on record	5
Natural History Museum Rotterdamlocation not on record	5
Helsinki, FI	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Stockholm, SE	1
CASlocation not on record	1
DASSHlocation not on record	1
RBINS-Scientific Heritagelocation not on record	1

17 institutions · 185 of 263 vouchered records shown · 34 without an institution code

09Environmental DNA52 detections

Where the DNA of Eriphia verrucosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 10.4–21.2

Seasonal swing summer↔winter7.80 °C

Max temp (day)16.1 °C 15.3–21.9

Min temp (night)13.4 °C 3.20–20.5

Precipitation50.8 mm/mo 41.1–105

Air humidity61.2 % 54.3–64.4

Moisture balance25.4 mm/mo

Vapour deficit708 Pa 599–964

Wind speed6.60 m/s

Cloud cover42.2 % 34.3–51.1

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eriphia verrucosa

At a glance

Sources12 archives

Size & morphology1

Habitat & environment2

Uses & economy1

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 554 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 554 records