Eriocoma parishii

(Vasey) Romasch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Eriocoma

At a glance

Occurrence records41

Data sources7

Biological traits13

DNA specimens0

eDNA detections4

Sources7 archives

Databases and archives Eriocoma parishii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF41 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingNCBIsequences

01Narrative

Stipa parishii, formerly classified as Achnatherum parishii, is a species of grass known by the common name Parish's needlegrass.CalFlora Database: Stipa parishii . accessed 8.2.2013 The Jepson Manual 2nd edition (2012) reclassified the plant as Stipa parishii var. parishii.Jepson eFlora: Stipa parishii var. parishii . accessed 8.2.2013CalFlora Database: Stipa parishii var. parishii . accessed 8.2.2013

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.29 mg

Seed mass max2.29 mg

Seed mass min2.29 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriocoma parishii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU489092.1 ↗588 bpUSA

ACGT

TCGTGACCCTGACCAAAATAGACCGCGCACACGTTATCCATCCTGCCGATGGCGGCACTGCCCGCCATCCGGCCAAGTCCCCTACCACCT …

Achnatherum parishii voucher Roos & Roos 4895 US internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor38

Museum / vouchered3

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 31≤1 km 1

32 georeferenced · 6 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	2
Pullman, US	1

2 institutions · 3 of 3 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Eriocoma parishii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Chaparral with Adenostoma fasciculatum, Aden…Oak Woodland & Desert Transition with Quercu…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 12.5–17.4

Seasonal swing summer↔winter21.7 °C

Max temp (day)21.8 °C 18.4–25.5

Min temp (night)9.20 °C 8.20–10.4

Precipitation44.5 mm/mo 6.60–79.6

Air humidity55.5 % 47.8–57.3

Moisture balance-98.0 mm/mo -179–-38.4

Vapour deficit825 Pa 733–1,047

Wind speed5.20 m/s 2.60–5.80

Cloud cover32.8 % 27.2–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)