Eriochilus scaber

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Eriochilus

At a glance

Occurrence records101

Data sources5

Biological traits23

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eriochilus scaber's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility101 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF101 records

DNA & barcodingNCBIsequences

01Narrative

Eriochilus scaber is a plant in the orchid family Orchidaceae and is endemic to Western Australia. It has a single leaf and up to three small red, pink and white flowers. Two subspecies are recognised based on the shape of the leaf and its height above the ground.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology5

Leaf length19 mm

Leaf width10 mm

Plant height0.15 m

Plant height max0.15 m

Plant height min0.05 m

Life cycle & reproduction6

Flowering timennnnnnyyynnn

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriochilus scaber has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSGQ866507.1 ↗706 bp

ACGT

ATCATTGTCGAGACCCAAAAAGAGACCGAGCAAATCTGACAACACGTGAATTAAAAAATTGGCGGCGGCGAAAGCCGGCGCCACACACCC …

Eriochilus scaber voucher H Richards 554 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type101 records

Wild obs. + sensor42

Museum / vouchered57

Cultivated / captive2

Origin

Native2

Range

Area of Occupancy AOO316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 10≤1 km 3≤10 km 1>10 km 8

22 georeferenced · 20 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 3≤1 km 6≤10 km 30>10 km 12

51 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence57

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	21
Museo Entomologico de Leonlocation not on record	15
Smithfield, AU	4
Kensington, AU	3
Brisbane, AU	3
Hobart, AU	2
Mount Annan, AU	2
LDlocation not on record	1
Adelaide, AU	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Wellington, NZ	1
Philadelphia, US	1
Tampa, US	1

13 institutions · 56 of 57 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)