Eriochilus dilatatus

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Eriochilus

At a glance

Occurrence records734

Data sources7

Biological traits26

DNA specimens1

eDNA detections2

Sources7 archives

Databases and archives Eriochilus dilatatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility734 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF734 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Eriochilus dilatatus subsp. brevifolius, commonly known as the blunt-leaved bunny orchid, is a plant in the orchid family Orchidaceae and is endemic to Western Australia. It has a single small, smooth leaf with wavy edges and a pale red lower surface, and up to three greenish and white flowers with red or mauve markings. It is distinguished from the other subspecies by the colour of the lower surface of its leaf and by its later flowering period.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Leaf length37.5 mm

Leaf width11 mm

Plant height0.4 m

Plant height max0.45 m

Plant height min0.1 m

Seed mass0.005 mg

Life cycle & reproduction6

Flowering timenyyyyyynnnnn

Life formtuberous geophyte

Life spanperennial

⚠ sources differ — AusTraits: perennial · GIFT: annual

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriochilus dilatatus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSGQ866505.1 ↗704 bp

ACGT

ATCATTGTCGAGACCCAAAACGAGACCGAGCAAATCTGACAACACGTGAATTAAAAAATTGGCGGCGGCGAAAGCCGGCGCCACACACCC …

Eriochilus multiflorus voucher G Brockman 1586 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type734 records

Wild obs. + sensor696

Museum / vouchered32

Cultivated / captive6

Origin

Native5

Range

Area of Occupancy AOO1 888 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 329≤1 km 168≤10 km 21>10 km 48

566 georeferenced · 130 without coordinates

Open the mapobservation + sensor696

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 2≤1 km 6≤10 km 13>10 km 3

24 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence32

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 5

6 georeferenced

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	7
Canberra, AU	7
Brisbane, AU	3
BGPAlocation not on record	3
Museo Entomologico de Leonlocation not on record	2
Mount Annan, AU	2
Wellington, NZ	1
Tampa, US	1
Joondalup, AU	1
Philadelphia, US	1
Smithfield, AU	1
QVMAGlocation not on record	1

12 institutions · 30 of 32 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Eriochilus dilatatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)