Eriochilus cucullatus

(Labill.) Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Eriochilus

At a glance

Occurrence records5 062

Data sources7

Biological traits33

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Eriochilus cucullatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 062 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF5 062 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Eriochilus cucullatus, commonly known as parson's bands, or leafless parson's bands, is a plant in the orchid family Orchidaceae and is endemic to Australia. It is a common and widespread, slender ground orchid with a single leaf and up to five small white to pale pink flowers. It grows in all Australian states except Western Australia and the Northern Territory. flowers with index finger for scale Thomas Chalmers with parson's bands

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Leaf length22.5 mm

Leaf length max35 mm

Leaf length min8 mm

Leaf size330 mm²

Leaf width9 mm

Plant height0.07 m

Plant height max0.3 m

Plant height min0.04 m

Seed mass0.001 mg

Life cycle & reproduction11

Dispersal typewind

Flowering endMay

Flowering startDec

Flowering timeyyyyynnnnnny

Life formtuberous geophyte

Life spanperennial

Lifespan years15 years

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproductive maturity1.5 years

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriochilus cucullatus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF348030.1 ↗700 bp

ACGT

ATCATTGTCGAGACCCAAAAGAGACCGAGCAAATCTGACAACATGTGAACTAAAAAATTGGCGTCGACGAAAGCCGGCGCCACACACCCA …

Eriochilus cucullatus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type5 062 records

Wild obs. + sensor3 865

Museum / vouchered1 152

Cultivated / captive45

Origin

Native578

Introduced2

Range

Area of Occupancy AOO12 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 1 893≤1 km 951≤10 km 396>10 km 243

3 483 georeferenced · 382 without coordinates

Open the mapobservation + sensor3 865

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 137≤1 km 282≤10 km 514>10 km 100

1 033 georeferenced · 119 without coordinates

Open the institutions mapphysical evidence1 152

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy40% within 1 km

≤100 m 10≤1 km 7≤10 km 24>10 km 2

43 georeferenced · 2 without coordinates

Open the mapnot free-living45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	369
Museo Entomologico de Leonlocation not on record	200
Mount Annan, AU	163
Adelaide, AU	128
Hobart, AU	73
Brisbane, AU	56
Armidale, AU	43
Smithfield, AU	34
QVMAGlocation not on record	17
NSW Dept of Planning, Industry and Environmentlocation not on record	10
Parkville, AU	9
Batemans Bay, AU	5
Kensington, AU	4
Paris, FR	1
Tampa, US	1
John T. Waterhouse Herbariumlocation not on record	1
La Trobe Universitylocation not on record	1

17 institutions · 1 115 of 1 152 vouchered records shown · 37 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Eriochilus cucullatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eriochilus cucullatus

At a glance

Sources7 archives

Size & morphology9

Life cycle & reproduction11

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

At a glance

Record type5 062 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type5 062 records