Eriocephalus racemosus

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eriocephalus

At a glance

Occurrence records258

Data sources5

Biological traits16

DNA specimens1

eDNA detections2

Sources5 archives

Databases and archives Eriocephalus racemosus's data was compiled from.

GBIFGlobal Biodiversity Information Facility258 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF258 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max2 m

Plant height min1.2 m

Seed mass6.41 mg

Seed mass max6.41 mg

Seed mass min6.41 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max200 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eriocephalus racemosus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF155771.1 ↗642 bp

ACGT

TCGAAACCTGCAAAGCAGAACGACCCGTGAACATGTAACAACAACCGGGTGTTGGGTGGGTTGAGCACTTGCTTGATCCTCTCAATGCTT …

Eriocephalus racemosus isolate EriocephalrK107 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type258 records

Wild obs. + sensor243

Museum / vouchered15

Range

Area of Occupancy AOO532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 193≤1 km 17≤10 km 4>10 km 1

215 georeferenced · 28 without coordinates

Open the mapobservation + sensor243

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3>10 km 1

4 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	3
Bronx, US	2
Cape Town, ZA	2
MSB-3054location not on record	2
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	2
University of Stellenboschlocation not on record	2
Philadelphia, US	1
Uppsala, SE	1

8 institutions · 15 of 15 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Eriocephalus racemosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 13.5–13.5

Seasonal swing summer↔winter12.5 °C

Max temp (day)20.1 °C

Min temp (night)7.60 °C

Precipitation37.8 mm/mo

Air humidity54.5 %

Moisture balance-69.1 mm/mo

Vapour deficit706 Pa

Wind speed4.60 m/s

Cloud cover9.90 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)