Erimyzon sucetta

(Lacepède, 1803) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Catostomidae/Erimyzon

At a glance

Occurrence records5 746

Data sources9

Biological traits5

DNA specimens105

eDNA detections96

Sources9 archives

Databases and archives Erimyzon sucetta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 746 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI96 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics105 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF5 746 records

Environmental DNA1 datasets · 2 countries96 detections

DNA & barcodingBOLD105 specimens

01Narrative

The lake chubsucker (Erimyzon sucetta) is a freshwater fish endemic to North America, found in the Great Lakes and the Mississippi River basin, as far north as Ontario, Canada, extending south to the Gulf of Mexico. It is mainly found in lakes, ponds, and swamps, rarely in streams.Fishbase. Erimyzon sucetta. 2010. http://www.fishbase.org/summary/speciessummary.php?id=2987 The fish is an intermediate level consumer that feeds on benthic detritus, specifically on microcrustacea and midge larvae.Snodgrass, Joel W., Charles H. Jagoe, A. Lawrence Bryan Jr., Heather A. Brant and J. Burger. 2000. Effects of trophic status and wetland morphology, hydroperiod, and water chemistry on mercury concentrations in fish. Canadian Journal of Fisheries and Aquatics 58:(7) 1419-1429. Its average length is 25.8 cm. E. sucetta reportedly scatters its eggs randomly over aquatic vegetation and submerged grass in ponds Page, Lawrence M. and Carol E. Johnston. 1989. Spawning in the creek chubsucker,Erimyzon oblongus, with a review of spawning behavior in suckers (Catostomidae) Environmental Biology of Fishes 27:265-272. or over gravelly areas cleared by males.NatureServe Explorer. Erimyzon sucetta. 2008. http://www.natureserve.org/explorer/servlet/NatureServe?searchName=Erimyzon%20sucetta While not in acute danger, the chubsucker faces habitat disturbance due to siltation caused by agricultural practices as well as coal ash spills.Hopkins, W.A., J.W Snodgrassa, J.H Roea, B.P Stauba, B.P Jacksona, and J.D Congdona. 2002. Effects of food ration on survival and sublethal responses of lake chubsuckers (Erimyzon sucetta) exposed to coal combustion wastes. Aquatic Toxicology 57:191-202. Its range has declined in Missouri, Arkansas, Ohio, and possibly Tennessee.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length41 cm

Life cycle & reproduction1

Max. longevity96 months

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

Other traits1

Vulnerability31

05DNA & barcoding105 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erimyzon sucetta has left across the world's sequence archives.

At a glance

DNA specimens105

BINs3

Marker genes3

eDNA detections96

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P623 bp consensus95 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

49Tmostly conserved

145Gmostly conserved

148Tmostly conserved

265Tmostly conserved

283Gmostly conserved

307Amostly conserved

400Cmostly conserved

521Tmostly conserved

547Gmostly conserved

560Tmostly conserved

TGCCTGAGCCGGAATAGTAGGAACCGCCTTAAGCCTTCTAATTCGAGCTGAATTAAGTCAACCCGGATCTCTTCTAGGTGATGACCAAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes7

BINs3

Most divergent pair2.2%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Erimyzon tenuissame genus3.4%Erimyzon oblongussame genus6.1%Erimyzon claviformissame genus6.2%Catostomus occidentalissame family9.0%Catostomus columbianussame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12SRho

animal barcodemarker

07Deep time~4.97 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin4.97 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type5 746 records

Wild obs. + sensor3 320

Museum / vouchered2 407

Fossil14

Other5

Origin

Native241

Range

Area of Occupancy AOO9 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 189≤1 km 47≤10 km 14>10 km 88

338 georeferenced · 2 982 without coordinates

Open the mapobservation + sensor3 320

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 193≤1 km 65≤10 km 150>10 km 43

451 georeferenced · 1 956 without coordinates

Open the institutions mapphysical evidence2 407

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	843
North Carolina Museum of Natural Scienceslocation not on record	306
University of Alabamalocation not on record	193
Ann Arbor, US	180
University of Texas Biodiversity Collections (UTBC)location not on record	165
Champaign, US	164
Montgomery, US	123
Washington, US	98
Ohio State University - Fish Division, Columbus, OH (OSUM)location not on record	93
Texas Memorial Museum, Texas Natural History Collectionlocation not on record	61
Cambridge, US	28
Texas Cooperative Wildlife Collectionlocation not on record	25
Southeastern Louisiana University, Vertebrate Museumlocation not on record	20
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	17
Chicago, US	16
Los Angeles, US	14
New Haven, US	12
Louisiana State University, Museum of Zoologylocation not on record	8
CASlocation not on record	7
Vancouver, CA	3
Sam Noble Oklahoma Museum of Natural Historylocation not on record	3
University of Minnesota, James Ford Bell Museum of Natural Historylocation not on record	3
Florida State University Coastal and Marine Laboratorylocation not on record	3
South African Institute for Aquatic Biodiversitylocation not on record	2
Central Michigan University Museum of Cultural and Natural Historylocation not on record	1
Paris, FR	1
München, DE	1
University of Nebraska State Museumlocation not on record	1
Stockholm, SE	1
ISUAlocation not on record	1

30 institutions · 2 393 of 2 407 vouchered records shown · 14 without an institution code

09Environmental DNA96 detections

Where the DNA of Erimyzon sucetta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found96

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 96 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 14.7–25.6

Seasonal swing summer↔winter20.3 °C

Max temp (day)25.1 °C 20.1–30.9

Min temp (night)17.4 °C 10.2–20.8

Precipitation102 mm/mo 82.9–120

Air humidity58.3 % 57.6–59.9

Moisture balance-40.5 mm/mo -54.6–1.20

Vapour deficit1,020 Pa 739–1,373

Wind speed2.70 m/s 2.10–4.80

Cloud cover34.9 % 32.7–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Erimyzon sucetta

At a glance

Sources9 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment2

Other traits1

At a glance

At a glance

When this lineage existed

Record type5 746 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 746 records