Eremophila tetraptera

C.T.White · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records45

Data sources5

Biological traits14

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila tetraptera's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources14 traits

Occurrence & distributionGBIF45 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila tetraptera is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Queensland. It is a shrub or small tree with narrow, lance-shaped leaves often crowded on short side branches, red flowers and unusual four-winged fruits resembling those of hop bushes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length50 mm

Leaf width6.5 mm

Plant height3 m

Seed length3.8 mm

Seed width1.25 mm

Life cycle & reproduction3

Life formshrub

Life spanperennial

Sex typehermaphrodite

Habitat & environment5

Climatedesert or dry shrubland

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila tetraptera has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411537.1 ↗7 692 bpAustralia

ACGT

TTCACGCCACTTTCGGCTTTTTTTTCATAATTATTAATAATTTCGCAATATTTAATTAATAAATAAATTAAATAAATAATTTTCGGAGCA …

Eremophila tetraptera isolate RMF175 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type45 records

Wild obs. + sensor7

Museum / vouchered37

Other1

Origin

Native1

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced · 2 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 8≤1 km 1≤10 km 23>10 km 1

33 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	18
Adelaide, AU	8
Palmerston, AU	4
Parkville, AU	2
Canberra, AU	2
Mount Annan, AU	1
Museo Entomologico de Leonlocation not on record	1
Kew, GB	1

8 institutions · 37 of 37 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)