Eremophila subteretifolia

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records35

Data sources5

Biological traits20

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila subteretifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF35 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila subteretifolia, commonly known as Lake King eremophila, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a creeping, prostrate shrub with narrow, sticky, dark green leaves and distinctive orange-red to yellow flowers. It is a rare plant which grows near the edges of salt lakes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Leaf length15.5 mm

Leaf width1.1 mm

Plant height0.15 m

Plant height max0.15 m

Plant height min0.04 m

Seed length2 mm

Seed mass6.95 mg

Seed width0.8 mm

Life cycle & reproduction3

Flowering timennnnnnnnnnyy

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila subteretifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411433.1 ↗7 463 bpAustralia

ACGT

TTCAACCCACTTTCCACATTTTTTTCTAATTATTAATATTTTCGCAATATTTTATCAATAAATAAATTAAATAAATATTTTTTGGACAAA …

Eremophila subteretifolia isolate MJB2356 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type35 records

Museum / vouchered31

Cultivated / captive4

Origin

Native1

Range

Area of Occupancy AOO60 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤1 km 1≤10 km 27

28 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence31

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced

Open the mapnot free-living4

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	15
Adelaide, AU	8
Museo Entomologico de Leonlocation not on record	2
Canberra, AU	2
Stockholm, SE	1
Kew, GB	1
Mount Annan, AU	1
Saint Louis, US	1

8 institutions · 31 of 31 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)