Eremophila sturtii

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records4 777

Data sources11

Biological traits40

DNA specimens3

eDNA detections1

Sources11 archives

Databases and archives Eremophila sturtii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 777 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF4 777 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila sturtii, commonly known as turpentine bush, is a shrub endemic to Australia. Aboriginal people give it names including munyunpa and watara. A medium to large shrub, it is often multi-stemmed and has narrow leaves and lilac-coloured to pale mauve flowers. It is widespread and common in the drier parts of Australia and occurs in all mainland states, although it is endangered in Victoria. It is sometimes regarded as a weed, partly because of its ability to reproduce vegetatively.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology18

Fruit length4.25 mm

Fruit width3 mm

Leaf length30 mm

Leaf length max50 mm

Leaf length min10 mm

Leaf mass8 mg

Leaf mass per area226 g/m2

Leaf size141 mm²

⚠ sources differ — TRY: 141 mm² · AusTraits: 34.9 mm²

Leaf width1.9 mm

Leaf width max3 mm

Leaf width min0.5 mm

Plant height3 m

⚠ sources differ — AusTraits: 3 m · TRY: 4 m

Plant height max3 m

Seed length2 mm

Seed mass0.15 mg

⚠ sources differ — TRY: 0.15 mg · AusTraits: 0.15 mg · GIFT: 3.71 mg

Seed mass max3.71 mg

Seed mass min3.71 mg

Seed width1 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Flowering timeyynnnnnnyyyy

Life formshrub

Life spanperennial > 20 years

⚠ sources differ — TRY: perennial > 20 years · AusTraits: perennial · GIFT: perennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear terete

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)857 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)4.79 mm²/mg

03Chemical composition2 compounds

Compounds documented for Eremophila sturtii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Serrulatane and Biflorane diterpenoids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(5R,7R,8S)-4,7-dihydroxy-5-methyl-8-[(2S)-6-methylhept-5-en-2-yl]-5,6,7,8-tetrahydronaphthalene-2-carboxylic acid		present	LOTUS
(5R,8S)-5-Methyl-8-(6-methylhept-5-en-2-yl)-5,6,7,8-tetrahydronaphthalene-2-carboxylic acid		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila sturtii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF828446.1 ↗419 bpAustralia · 2011

ACGT

TGCAGAATCCCGTGAACCATGGAGTTTTTGAACGCAAGTTGCGCCGGAAGCCATTAGGCCGAGGGCAGGTCGGCCTGGGGGTCAGGCATG …

Eremophila sturtii voucher T07_SMPRS 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila sturtii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 777 records

Wild obs. + sensor3 727

Museum / vouchered1 016

Other34

Origin

Native465

Range

Area of Occupancy AOO11 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 3 303≤1 km 121≤10 km 108>10 km 35

3 567 georeferenced · 160 without coordinates

Open the mapobservation + sensor3 727

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 163≤1 km 225≤10 km 386>10 km 146

920 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence1 016

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	304
Canberra, AU	195
Mount Annan, AU	117
Museo Entomologico de Leonlocation not on record	104
Brisbane, AU	92
Palmerston, AU	64
NSW Dept of Planning, Industry and Environmentlocation not on record	28
Armidale, AU	22
John T. Waterhouse Herbariumlocation not on record	14
Hobart, AU	10
University of Stellenboschlocation not on record	4
Kensington, AU	3
Kew, GB	3
IPA/SPlocation not on record	2
Parkville, AU	2
Christchurch, NZ	2
Wollongong, AU	1
EL PASO, US	1
Australian Museum, Sydneylocation not on record	1
Smithfield, AU	1

20 institutions · 970 of 1 016 vouchered records shown · 46 without an institution code

09Environmental DNA1 detections

Where the DNA of Eremophila sturtii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter16.8 °C

Max temp (day)14.6 °C

Min temp (night)5.80 °C

Precipitation25.3 mm/mo

Air humidity56.9 %

Moisture balance-30.0 mm/mo

Vapour deficit525 Pa

Wind speed3.40 m/s

Cloud cover16.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila sturtii

At a glance

Sources11 archives

Size & morphology18

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 777 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 777 records