Eremophila serrulata

(A.DC.) Druce · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records1 438

Data sources10

Biological traits36

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Eremophila serrulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 438 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Chemical compositionLOTUS · NPASS65 compounds

Occurrence & distributionGBIF1 438 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila serrulata, commonly known as serrate-leaved eremophila, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is an erect or spreading shrub whose leaves are sticky and have small serrations, and flowers that have green, yellowish-green or yellowish-brown petals.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length6.25 mm

Fruit width6.25 mm

Leaf length35.5 mm

Leaf length max60 mm

Leaf length min20 mm

Leaf width9.5 mm

Leaf width max10 mm

Leaf width min9 mm

Plant height2.25 m

Plant height max2.5 m

Plant height min0.25 m

Seed length2.5 mm

Seed mass36.78 mg

⚠ sources differ — TRY: 36.78 mg · AusTraits: 30.06 mg · GIFT: 36.78 mg

Seed mass max36.78 mg

Seed mass min36.78 mg

Seed width0.8 mm

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennyyyyyyynnn

Life formshrub

Life spanperennial

Pollination syndromebird

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapelanceolate ovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition65 compounds

Compounds documented for Eremophila serrulata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Unsaturated fatty acids6

Labdane diterpenoids6

Menthane monoterpenoids $ Monocyclic monoterpenoids4

Ursane and Taraxastane triterpenoids4

Flavonols4

Documented compounds65 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-gamma-Tocopherol	present	NPASS
(+)-Ursolic Acid	present	NPASS
(1S,4AS,7S,7aS)-7-hydroxy-7-methyl-1-(((2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(((4-hydroxybenzoyl)oxy)methyl)tetrahydro-2H-pyran-2-yl)oxy)-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylic acid	present	NPASS
(2E)-2-[(4aS,5R,7R,8R,8aS)-5-acetyloxy-4,4,7,8a-tetramethylspiro[2,3,4a,5,6,7-hexahydro-1H-naphthalene-8,5'-oxolane]-2'-ylidene]acetic acid	present	NPASS
(2S,3S,4R)-4-[(3S)-3-hydroxy-3-methylpent-4-enyl]-3,4,8,8-tetramethyl-2,3,6,7-tetrahydronaphthalen-2-ol	present	NPASS
(2S,4aS,10aR)-1,1,4a-trimethyl-7-propan-2-yl-2,3,4,9,10,10a-hexahydrophenanthren-2-ol	present	NPASS
(3R,4R,4aS,8aS)-4-[2-(furan-3-yl)ethyl]-4-hydroxy-3,4a,8,8-tetramethyl-2,3,5,6,7,8a-hexahydronaphthalen-1-one	present	NPASS
(4S)-12-methyl-4-(4-methylpent-3-enyl)-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8-tetraene-10,11-dione	present	LOTUS
(5R,8S)-4-acetyloxy-5-(acetyloxymethyl)-8-[(2S)-6-methylhept-5-en-2-yl]-5,6,7,8-tetrahydronaphthalene-2-carboxylic acid	present	LOTUS
(5R,8S)-4-hydroxy-5-(hydroxymethyl)-8-[(2S)-6-methylhept-5-en-2-yl]-5,6,7,8-tetrahydronaphthalene-2-carboxylic acid	present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila serrulata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411468.1 ↗7 412 bpAustralia

ACGT

TTCCAACACTATTTCCATATTTTTTCTTAATTATTATTTTTTGCAATATTTAATCAAAAAGAAATTAAATAAATATTTTTCAGAGATAAA …

Eremophila serrulata isolate MJB2404 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila serrulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 438 records

Wild obs. + sensor589

Museum / vouchered845

Cultivated / captive4

Origin

Native419

Introduced1

Range

Area of Occupancy AOO4 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 402≤1 km 51≤10 km 34>10 km 5

492 georeferenced · 97 without coordinates

Open the mapobservation + sensor589

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 136≤1 km 216≤10 km 335>10 km 88

775 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence845

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 3

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	389
Kensington, AU	135
Canberra, AU	68
Mount Annan, AU	53
Museo Entomologico de Leonlocation not on record	45
Palmerston, AU	31
Brisbane, AU	17
Armidale, AU	11
Hobart, AU	10
Parkville, AU	6
John T. Waterhouse Herbariumlocation not on record	6
BGPAlocation not on record	6
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Kew, GB	2
Beijing, CN	1
EL PASO, US	1
Riverside, US	1
Claremont, US	1
Moscow State Universitylocation not on record	1
Miami, US	1
University of Stellenboschlocation not on record	1
Smithfield, AU	1

22 institutions · 790 of 845 vouchered records shown · 55 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila serrulata

At a glance

Sources10 archives

Size & morphology16

Life cycle & reproduction7

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

Compound class profile5 classes

Documented compounds65 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 438 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 22 geolocated

Cultivated / Captivenot free-living

Record type1 438 records