Eremophila scoparia

(R.Br.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records3 445

Data sources8

Biological traits37

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Eremophila scoparia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 445 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF3 445 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila scoparia, commonly known as silver emubush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a broom-like shrub with narrow, hooked leaves, small sepals and deep lilac-coloured to white petals and is common and widespread in southern parts of the continent.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology15

Fruit length4.25 mm

Fruit width2.75 mm

Leaf length15 mm

Leaf length max29 mm

Leaf length min6 mm

Leaf mass per area283 g/m2

Leaf width2.4 mm

Leaf width max2.5 mm

Leaf width min1 mm

Plant height3 m

Plant height max3 m

Plant height min0.5 m

Seed length2.5 mm

Seed mass10.88 mg

Seed width1 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnyyyyyyn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub · TRY: Angiosperm

Leaf compoundnesssimple

Leaf shapelinear terete

Woodinesswoody

Physiology & chemistry4

Leaf n15.69 mg/g

Leaf p1.1 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition2 compounds

Compounds documented for Eremophila scoparia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Eudesmane sesquiterpenoids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(4aR,6S,7S,8aS)-7-hydroxy-6-(2-hydroxypropan-2-yl)-4,8a-dimethyl-1,4a,5,6,7,8-hexahydronaphthalen-2-one		present	LOTUS
(4aS,6S,7S,8aS)-7-hydroxy-6-(2-hydroxypropan-2-yl)-4,8a-dimethyl-1,4a,5,6,7,8-hexahydronaphthalen-2-one		present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila scoparia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411546.1 ↗7 425 bpAustralia

ACGT

TTCAACCCACTTTCCACATTTTTTTCTAATTATTAGTATTTTGCAATATTTAATTAATAAATAAATTAAATAAATATTTTTCGGAGCAAA …

Eremophila scoparia isolate RMF194 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL6★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila scoparia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 445 records

Wild obs. + sensor2 199

Museum / vouchered1 240

Cultivated / captive1

Other5

Origin

Native1 566

Range

Area of Occupancy AOO8 736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 279≤1 km 400≤10 km 297>10 km 25

2 001 georeferenced · 198 without coordinates

Open the mapobservation + sensor2 199

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 218≤1 km 303≤10 km 465>10 km 155

1 141 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence1 240

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	581
Kensington, AU	176
Canberra, AU	136
Museo Entomologico de Leonlocation not on record	103
Mount Annan, AU	49
Brisbane, AU	24
Hobart, AU	14
BGPAlocation not on record	13
Palmerston, AU	11
Parkville, AU	11
Kew, GB	7
John T. Waterhouse Herbariumlocation not on record	5
MAlocation not on record	5
Stockholm, SE	4
EL PASO, US	4
Armidale, AU	3
Claremont, US	2
MeiseBGlocation not on record	2
La Trobe Universitylocation not on record	2
Moscow State Universitylocation not on record	1
Joondalup, AU	1
University of Stellenboschlocation not on record	1
JBRJlocation not on record	1
Christchurch, NZ	1
Wellington, NZ	1
Beijing, CN	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1

27 institutions · 1 160 of 1 240 vouchered records shown · 80 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila scoparia

At a glance

Sources8 archives

Size & morphology15

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 445 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 27 geolocated

Cultivated / Captivenot free-living

Record type3 445 records