Eremophila sargentii

(S.Moore) Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records30

Data sources5

Biological traits21

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila sargentii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Occurrence & distributionGBIF30 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila sargentii is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a shrub with sticky, shiny foliage, small leaves and mauve or blue flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Leaf length4.25 mm

Leaf width1 mm

Plant height2 m

Plant height max2 m

Plant height min0.3 m

Seed mass5.14 mg

Seed mass max5.14 mg

Seed mass min5.14 mg

Life cycle & reproduction4

Flowering timennnnnnnyyynn

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila sargentii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411515.1 ↗7 462 bpAustralia

ACGT

TTCAGCCAACTTACCATATTTTTTCTAATTATTAATATTTTCGCAATATTTTATTAATAAATAAATTAAATAAATATTTTTCGGTGCAAA …

Eremophila sargentii isolate RMF123 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor2

Museum / vouchered27

Cultivated / captive1

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 27

27 georeferenced

Open the institutions mapphysical evidence27

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	15
Adelaide, AU	7
Canberra, AU	3
Brisbane, AU	1
BGPAlocation not on record	1

5 institutions · 27 of 27 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)