Eremophila saligna

(S.Moore) C.A.Gardner · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records86

Data sources5

Biological traits23

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila saligna's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility86 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF86 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila saligna, commonly known as willowy eremophila, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is an upright shrub with narrow, serrated leaves, cylindrical flowers and cream to white petals.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length45 mm

Leaf width5 mm

Plant height3 m

Plant height max3 m

Plant height min0.9 m

Seed length1.5 mm

Seed width0.5 mm

Life cycle & reproduction6

Dispersal typeanimal

Flowering timennnnnnnnyynn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila saligna has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN486179.1 ↗7 447 bpAustralia

ACGT

TTCAACCCATTTTTACCCATTATTAGTATTTTCGCAATATTTAATCATAAATAAATTAAATAAATAATTTTCTGAGCAAAAATTATTTAT …

Eremophila saligna isolate RMF36 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type86 records

Wild obs. + sensor8

Museum / vouchered78

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 6>10 km 2

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 9≤1 km 12≤10 km 40>10 km 4

65 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	40
Adelaide, AU	19
Canberra, AU	7
BGPAlocation not on record	4
Palmerston, AU	3
Museo Entomologico de Leonlocation not on record	2
Kew, GB	2
Brisbane, AU	1

8 institutions · 78 of 78 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)