Eremophila rotundifolia

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records405

Data sources10

Biological traits19

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Eremophila rotundifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility405 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF405 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila rotundifolia is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a shrub with many tangled branches with its leaves and branches covered with a layer of silvery-grey hairs. Its flowers range in colour from pale to deep lilac. It is common in South Australia and there is also a single record from the Northern Territory.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Fruit length7.5 mm

Fruit width3.5 mm

Leaf length13 mm

Leaf width8.75 mm

Plant height1.5 m

Life cycle & reproduction5

Dispersal typeanimal

Life formshrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Eremophila rotundifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Bisabolane sesquiterpenoids1

Eremophilane sesquiterpenoids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3S,5S)-1-(furan-3-yl)-5-methyl-3-(2-methylprop-1-enyl)-2,8-dioxabicyclo[3.2.1]octane	present	LOTUS
(Z)-5-((E)-5-(Furan-3-yl)-2-methylpent-2-en-4-yn-1-ylidene)-3-methylfuran-2(5H)-one	present	LOTUS
2-[(2S,8S,8aR)-8,8a-dimethyl-4-oxo-1,2,3,6,7,8-hexahydronaphthalen-2-yl]prop-2-enal	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila rotundifolia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ444240.1 ↗609 bpAustralia

ACGT

TGTCGAAACCTGCAAAAGCAGCAGACCTGTAACACGTATATAAACTACCTTGGATTCCGGCTCGGGGCCAGCCCCTTGTCGTGTCCGCCC …

Eremophila rotundifolia internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila rotundifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type405 records

Wild obs. + sensor173

Museum / vouchered232

Origin

Native135

Range

Area of Occupancy AOO1 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 113≤1 km 20≤10 km 13>10 km 3

149 georeferenced · 24 without coordinates

Open the mapobservation + sensor173

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 23≤1 km 66≤10 km 79>10 km 53

221 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence232

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	164
Museo Entomologico de Leonlocation not on record	13
Palmerston, AU	10
Brisbane, AU	10
Canberra, AU	9
Mount Annan, AU	3
University of Stellenboschlocation not on record	1
Armidale, AU	1
EL PASO, US	1
Hobart, AU	1
Kew, GB	1
Parkville, AU	1
Wellington, NZ	1

13 institutions · 216 of 232 vouchered records shown · 15 without an institution code

09Environmental DNA1 detections

Where the DNA of Eremophila rotundifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)