Eremophila racemosa

(Endl.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records61

Data sources6

Biological traits23

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eremophila racemosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility61 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF61 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila racemosa, also known as showy eremophila, is a flowering plant in the figwort family Scrophulariaceae, and is endemic to Western Australia. It is an erect shrub with glabrous leaves, small, green sepals and flowers that have many colour variations often changing as they age.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology10

Leaf length30.5 mm

Leaf width4.2 mm

Plant height1.6 m

Plant height max1.7 m

Plant height min0.5 m

Seed length4.5 mm

Seed mass435 mg

Seed mass max435 mg

Seed mass min435 mg

Seed width1.5 mm

Life cycle & reproduction4

Flowering timennyyyyyyyyyy

Life formsubshrub or shrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Eremophila racemosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Furofuranoid lignans2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(2S,3S,4S,5R,6R)-2-[4-[(3S,3aR,6S,6aR)-3-(3,4-dimethoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-6-yl]-2-methoxyphenoxy]-6-(hydroxymethyl)oxane-3,4,5-triol		present	LOTUS
Phillyrin		present	LOTUS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila racemosa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411543.1 ↗7 543 bpAustralia

ACGT

TTCAACTCACTTTCCATATTTTTTTCTAATTATTAATATTTTCGCTATATTTAACCAATAAATAAATTAAATAAATATTTTTCGTACCAA …

Eremophila racemosa isolate RMF189 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor3

Museum / vouchered57

Cultivated / captive1

Origin

Native2

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 1>10 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 56

56 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence57

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	29
Adelaide, AU	10
Museo Entomologico de Leonlocation not on record	7
Canberra, AU	5
Brisbane, AU	2
Mount Annan, AU	2
Parkville, AU	1
Kew, GB	1

8 institutions · 57 of 57 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)