Eremophila purpurascens

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records61

Data sources5

Biological traits18

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila purpurascens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility61 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF61 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila purpurascens, commonly known as purple eremophila, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is an erect, bushy shrub with warty leaves and spotted, pink to red flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length9.75 mm

Leaf width4.5 mm

Plant height1.5 m

Plant height max1.5 m

Plant height min0.3 m

Life cycle & reproduction4

Flowering timennnnnnnyyynn

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila purpurascens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411533.1 ↗7 537 bpAustralia

ACGT

TTCATGCCACTTTTCATATTTTTAAATAATTATTAATATTTTCGCAATATTTAATTAATAAATAAATTAAATAAATTATTTTCGGACCAA …

Eremophila purpurascens isolate RMF168 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor5

Museum / vouchered56

Origin

Native1

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 4

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤1 km 1≤10 km 53

54 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	29
Adelaide, AU	15
Canberra, AU	6
Museo Entomologico de Leonlocation not on record	3
Kew, GB	2
Palmerston, AU	1

6 institutions · 56 of 56 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)