Eremophila polyclada

(F.Muell.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records529

Data sources6

Biological traits34

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eremophila polyclada's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility529 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF529 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila polyclada, commonly known as twiggy emu-bush, flowering lignum, lignum fuchsia and desert lignum is a plant in the figwort family Scrophulariaceae and is endemic to Australia. It is a dense, spreading shrub with narrow leaves and white to pale lilac-coloured, purple-spotted flowers. It occurs in all mainland states except Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length10.75 mm

Fruit width5 mm

Leaf length40 mm

Leaf length max80 mm

Leaf length min15 mm

Leaf mass per area182 g/m2

Leaf size53 mm²

Leaf width2.2 mm

Leaf width max3.5 mm

Leaf width min1 mm

Plant height3 m

⚠ sources differ — AusTraits: 3 m · TRY: 2 m

Plant height max3 m

Seed mass1.14 mg

⚠ sources differ — TRY: 1.14 mg · AusTraits: 34.86 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyyyyynnnyyyy

Life formshrub

Life spanperennial > 20 years

⚠ sources differ — TRY: perennial > 20 years · AusTraits: perennial · GIFT: perennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila polyclada has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN380714.1 ↗7 542 bpAustralia

ACGT

TTCACACCACTTTTCGTATTTTTTAATAATTATTAATATTTTCGCAATATTTTATTAATAAATAAATAAAATAAATAATTTTCGGAGCAA …

Eremophila polyclada voucher CANB602763 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type529 records

Wild obs. + sensor201

Museum / vouchered321

Other7

Origin

Native54

Range

Area of Occupancy AOO1 436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 95≤1 km 12≤10 km 43>10 km 10

160 georeferenced · 41 without coordinates

Open the mapobservation + sensor201

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 49≤1 km 65≤10 km 121>10 km 57

292 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence321

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	78
Museo Entomologico de Leonlocation not on record	65
Canberra, AU	60
Mount Annan, AU	49
Adelaide, AU	47
Palmerston, AU	5
Armidale, AU	4
Kew, GB	3
Parkville, AU	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
John T. Waterhouse Herbariumlocation not on record	1

11 institutions · 316 of 321 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)