Eremophila phyllopoda

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records13

Data sources6

Biological traits17

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eremophila phyllopoda's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF13 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila phyllopoda is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is an erect or spreading shrub, sometimes round or flat-topped with sticky, hairy leaves and flowers ranging in colour from pink or lilac to purple.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length64 mm

Leaf width4.25 mm

Plant height2 m

Plant height max2 m

Plant height min0.7 m

Life cycle & reproduction3

Flowering timennnnnyyyyynn

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Eremophila phyllopoda across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Furofuranoid lignans2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Asarinin		present	LOTUS
Sesamin		present	LOTUS

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila phyllopoda has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR742839.1 ↗7 494 bp

ACGT

CTAATTATTAGTATTTTCGCAATATTTAATCAATAAATTAATTAAATAAATATTTTTCGGATCAAAAATTATATTTTCACATTATATTAT …

Eremophila phyllopoda subsp. obliqua isolate BMR07488 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type13 records

Wild obs. + sensor3

Museum / vouchered10

Origin

Native2

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 4≤10 km 4

8 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	3
Palmerston, AU	2
Adelaide, AU	2
Museo Entomologico de Leonlocation not on record	1
Kew, GB	1
Canberra, AU	1

6 institutions · 10 of 10 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)