Eremophila parvifolia

J.M.Black · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records20

Data sources5

Biological traits24

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila parvifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF20 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila parvifolia is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a shrub which has small, usually egg-shaped leaves and blackish flower buds which open to purple flowers which are white with purple spots inside. There are two subspecies, both of which are found in Western Australia and one which is also found in South Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology9

Fruit length3.25 mm

Fruit width2.5 mm

Leaf length3 mm

Leaf width1.1 mm

Plant height0.8 m

Plant height max1.5 m

Plant height min0.1 m

Seed length1.5 mm

Seed width0.8 mm

Life cycle & reproduction6

Dispersal typeanimal

Flowering timeyyyynyyyyyyy

Life formshrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila parvifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411396.1 ↗7 516 bpAustralia

ACGT

TTCAACCCACTTTCCACATTTTTTCCTAATTATTACTATTTTCGTAATATTTAATCAATAAATAAATTAAATAAATATTTTTCGGGCAAA …

Eremophila parvifolia subsp. auricampa isolate RMF200 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type20 records

Wild obs. + sensor7

Museum / vouchered13

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced · 2 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤1 km 7≤10 km 3>10 km 3

13 georeferenced

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	7
Canberra, AU	4
Hobart, AU	1
Palmerston, AU	1

4 institutions · 13 of 13 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)