Eremophila papillata — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records36

Data sources5

Biological traits15

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila papillata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility36 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources15 traits

Occurrence & distributionGBIF36 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila papillata is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is an erect, compact shrub with sticky, narrow leaves and mauve, blue or purple, rarely white flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology3

Leaf length10 mm

Leaf width1.2 mm

Plant height0.8 m

Life cycle & reproduction3

Flowering timennnnnnnynnnn

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila papillata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411538.1 ↗7 504 bpAustralia

ACGT

TTCAGCCCACTTTCCACATTTTTTCTAATTATTAATATTTTCGCAATATTTTATCAATAAATAAATTAAATAAATATTTTTCGGAGCAAA …

Eremophila papillata isolate RMF176 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type36 records

Wild obs. + sensor4

Museum / vouchered32

Origin

Native1

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 10≤1 km 3≤10 km 15>10 km 1

29 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	24
Adelaide, AU	6
Mount Annan, AU	1
Canberra, AU	1

4 institutions · 32 of 32 vouchered records shown