Eremophila pantonii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records312

Data sources6

Biological traits19

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eremophila pantonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility312 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF312 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila pantonii, commonly known as broombush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a broom-shaped shrub with narrow leaves which have a hooked tip, and blue or purple, sometimes white flowers in winter and spring.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology7

Leaf length16 mm

Leaf width2 mm

Plant height3 m

Plant height max3 m

Plant height min0.6 m

Seed length2 mm

Seed width1 mm

Life cycle & reproduction4

Flowering timennnnnnyyyyyy

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

03Chemical composition1 compounds

Compounds documented for Eremophila pantonii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Iridoids monoterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
NCGC00169681-03_C22H26O10_[(1S)-1-(beta-D-Glucopyranosyloxy)-5-hydroxy-1,4a,5,7a-tetrahydrocyclopenta[c]pyran-7-yl]methyl benzoate		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila pantonii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411474.1 ↗7 458 bpAustralia

ACGT

TTTCTAATTATTAGTATTTTCGCAATATTTTTAATAAATAAATTAAATAAATATTTTTCGTAGCAAAATTATTTTTTCAAGATACATTTG …

Eremophila pantonii isolate MJB2411 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type312 records

Wild obs. + sensor76

Museum / vouchered236

Origin

Native11

Range

Area of Occupancy AOO908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 59≤1 km 1≤10 km 4>10 km 1

65 georeferenced · 11 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 39≤1 km 28≤10 km 122>10 km 20

209 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence236

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	123
Adelaide, AU	53
Museo Entomologico de Leonlocation not on record	16
Canberra, AU	16
Mount Annan, AU	10
Brisbane, AU	6
Parkville, AU	4
Kew, GB	4
Palmerston, AU	2
Hobart, AU	1
John T. Waterhouse Herbariumlocation not on record	1

11 institutions · 236 of 236 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)