Eremophila ovata

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records62

Data sources5

Biological traits16

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila ovata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF62 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila ovata is a flowering plant in the figwort family, Scrophulariaceae and is endemic to the Northern Territory. It is a small, spreading, rounded shrub with hairy branches and leaves and pink or purple flowers which are white inside.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology6

Fruit length7.25 mm

Leaf length17.5 mm

Leaf width11.5 mm

Plant height1 m

Seed length2.5 mm

Seed width0.8 mm

Life cycle & reproduction4

Life formshrub

Life spanperennial

Resprouting capacityresprouts

Sex typehermaphrodite

Habitat & environment5

Climatedesert or dry shrubland

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila ovata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411510.1 ↗6 647 bpAustralia

ACGT

TTCGTGCGAATTCCACCAGACCCCTCGTCGAAGTGTGGCTATTGTATGTGGCAACCTGGGGCTAGGTTGCACCATTATTTTCCGTGCCTA …

Eremophila ovata isolate RMF115 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type62 records

Wild obs. + sensor14

Museum / vouchered48

Origin

Native6

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2>10 km 1

3 georeferenced · 11 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 6≤1 km 7≤10 km 28>10 km 6

47 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence48

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	25
Adelaide, AU	11
Museo Entomologico de Leonlocation not on record	6
Canberra, AU	3
Brisbane, AU	2
Mount Annan, AU	1

6 institutions · 48 of 48 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)