Eremophila oppositifolia

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records521

Data sources11

Biological traits31

DNA specimens0

eDNA detections0

Sources11 archives

Databases and archives Eremophila oppositifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility521 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Chemical compositionLOTUS · NPASS74 compounds

Occurrence & distributionGBIF521 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila oppositifolia, commonly known as weeooka, twin-leaf emu bush and mountain sandalwood, is a plant in the figwort family, Scrophulariaceae, and is endemic to Australia. It is a shrub or small tree with its leaves arranged in opposite pairs and has cream to red or sometimes maroon coloured flowers. It occurs in all mainland states, but not the Northern Territory.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology11

Fruit length5.75 mm

Fruit width2.5 mm

Leaf length90 mm

Leaf length max120 mm

Leaf length min30 mm

Leaf width3 mm

Leaf width max7 mm

Leaf width min1 mm

Plant height5 m

Plant height max10 m

Plant height min1 m

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnyyyyyyy

Life formshrub

Life spanperennial

Pollination syndromebird

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition74 compounds

Compounds documented for Eremophila oppositifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoquinoline alkaloids $ Protoberberine alkaloids12

Unsaturated fatty acids11

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids5

Aporphine alkaloids $ Isoquinoline alkaloids4

Steroidal alkaloids3

Documented compounds74 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Corlumine	present	LOTUS
(+)-Corydaline	present	NPASS
(+)-Corytuberine	present	NPASS
(+)-Lupanine	present	LOTUS
(-)-alpha-Narcotine	present	NPASS
(-)-Corycavine	present	NPASS
(-)-Hydrastine	present	LOTUS
(-)-Menthol	present	LOTUS
(-)-Tetrahydropalmatine	present	NPASS
(13Ar)-3,10-Dimethoxy-6,8,13,13A-Tetrahydro-5H-Isoquinolino(2,1-B)Isoquinoline-2,9-Diol	present	NPASS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila oppositifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411343.1 ↗6 309 bpAustralia

ACGT

ANTCTGTCCCATTCCGCCTTGGGCTGCGCCCCAATGGGGCTGTGGCTCGGGGTGGACCTCGAAAGCATTCGTGTGTACCACATCTCCCTC …

Eremophila oppositifolia subsp. angustifolia isolate MJB2401 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila oppositifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type521 records

Wild obs. + sensor402

Museum / vouchered116

Other3

Origin

Native129

Range

Area of Occupancy AOO1 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 211≤1 km 67≤10 km 40>10 km 29

347 georeferenced · 55 without coordinates

Open the mapobservation + sensor402

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 28≤1 km 28≤10 km 28>10 km 9

93 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	22
Mount Annan, AU	12
Canberra, AU	8
Hobart, AU	7
Palmerston, AU	6
John T. Waterhouse Herbariumlocation not on record	6
Armidale, AU	5
Brisbane, AU	4
Kew, GB	4
Stockholm, SE	3
Museo Entomologico de Leonlocation not on record	3
MAlocation not on record	3
Kensington, AU	2
JBRJlocation not on record	1
La Trobe Universitylocation not on record	1
University of Stellenboschlocation not on record	1
Joondalup, AU	1
Bronx, US	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Parkville, AU	1
Wellington, NZ	1
EL PASO, US	1

22 institutions · 94 of 116 vouchered records shown · 22 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)