Eremophila obovata

L.S.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records81

Data sources5

Biological traits24

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila obovata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility81 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF81 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila obovata is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a low, compact shrub with lilac to purple flowers growing mainly in the Northern Territory and Queensland but also Western Australia, South Australia and New South Wales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology8

Leaf length9.25 mm

Leaf width6.8 mm

Plant height0.5 m

Plant height max0.5 m

Plant height min0.2 m

Seed length3.5 mm

Seed mass55.82 mg

Seed width1.25 mm

Life cycle & reproduction6

Dispersal typeanimal

Flowering timennynnyyyyynn

Life formsubshrub or shrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila obovata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411378.1 ↗7 378 bpAustralia

ACGT

AAATTATATTTTCGCATTATATTACATTATAAAACATTTTTTAAGCCACATACAAATTTTCAAGCAAAATACATAAAAATACTACAAAAA …

Eremophila obovata subsp. obovata isolate RMF128 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type81 records

Wild obs. + sensor49

Museum / vouchered30

Other2

Origin

Native7

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 32≤10 km 4>10 km 1

37 georeferenced · 12 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 12≤1 km 2≤10 km 11

25 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	13
Canberra, AU	4
Beijing, CN	3
James Cook Townsvillelocation not on record	2
Hobart, AU	2
Adelaide, AU	2
EL PASO, US	1
Museo Entomologico de Leonlocation not on record	1
Brisbane, AU	1
Mount Annan, AU	1

10 institutions · 30 of 30 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)